Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Various betaproteobacteria

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azoarcus sp. EbN1
ebB35 groS -115 7.4 TTAGCACTCGTTGGCAGTGAGTGCTAA
ebA4241 rpoH -54 7 TTAGCACTCCAACGCCATGAGTGCTAA
Thauera sp. MZ1T
Tmz1t_1419 groS -144 7.5 TTAGCACTCGTTGGCGTCGAGTGCTAA
Tmz1t_1062 rpoH -55 7.1 TTAGCACTCTCACGCCCCGAGTGCTAA
Dechloromonas aromatica RCB
Daro_0425 groS -115 7.4 TTAGCACTCACCGGCGACGAGTGCTAA
Daro_3837 rpoH -61 7.1 TTAGCACTCTTATGCAGCGAGTGCTAA
Nitrosomonas europaea ATCC 19718
NE0027 groS -128 7.4 TTAGCACTCGTTGCTGTTGAGTGCTAA
NE0584 rpoH -85 7 TTAGCACTCATGAACTAAGAGTGCTAG
Nitrosospira multiformis ATCC 25196
Nmul_A2345 groS -120 7.3 TTAGCACTCATTGGCATTGAGTGCTAA
Thiobacillus denitrificans
Tbd_0092 groS -102 6.8 TCAGCACTCTATGGCGGCGAGTGCTAA
Tbd_0345 rpoH -52 7 TTAGCACTCCCAATGCGCGAGTGCTAA
Chromobacterium violaceum ATCC 12472
CV4015 groS -94 7.3 TTAGCACTCGCAATGGTCGAGTGCTAA
CV4206 rpoH -58 6.8 CTAGCACTCTCAATATTCGAGTGCTAA
Laribacter hongkongensis HLHK9
LHK_01878 groS -97 7 TTAGCACTCGTGAAGCGGGAGTGCTAA
LHK_00659 groS -97 6.9 TTGGCACTCGTGAGTGATGAGTGCTAA
LHK_00231 rpoH -55 6.7 TTATCACTCAACCAGGCCGAGTGCTAA
Methylobacillus flagellatus KT
Mfla_0365 groS -97 7.3 TTAGCACTCGATAGGGTTGAGTGCTAA
Mfla_0702 rpoH -55 6.3 CTAGCACACTCAAACAGTGAGTGCTAG
Methylotenera mobilis JLW8
Mmol_0429 groS -94 6.9 TTAGCAATCGAGGTGCGCGAGTGCTAA
Mmol_1814 rpoH -56 7 CTAGCACTCTCGAACGTAGAGTGCTAA
Methylophilales bacterium HTCC2181
MB2181_06400 groS -91 7 TTAGCACTCTATCAAGTTGAGTGCTAA
MB2181_02680 rpoH -47 7.1 TTAGCACTCTATAGGATTGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD