Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Comamonadaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_3894 rpoH -57 6.5 TTAGCACTCCCTCCAAGAGACTGCTAA
Aave_0946 groS -123 6.9 TTAGCACTCGAAGCGGACGAGTGCTAA
Acidovorax sp. JS42
Ajs_0700 groS -112 7.2 TTAGCACTCGAAACAGATGAGTGCTAA
Ajs_3522 rpoH -28 7 TTAGCACTCTCTCCAATGGAGTGCTAA
Comamonas testosteroni KF-1
CtesDRAFT_4575 groS -111 7 TTAGCACTCAATGGGGTTGAGTGCTAA
CtesDRAFT_2864 rpoH -28 6.8 TTAGCACTCTCTCTAACGGAGTGCTAA
Delftia acidovorans SPH-1
Daci_5660 groS -114 7 TTAGCACTCGTTGGGCATGAGTGCTAA
Daci_1694 rpoH -57 7 TTAGCACTCGGTCATAACGAGTGCTAA
Polaromonas naphthalenivorans CJ2
Pnap_0658 groS -134 6.8 TTAGCACTCGATGAGGTGGAGTGCTAA
Pnap_0889 rpoH -57 6 CTGGCACTCTCTCTGATGGAGTGCTAA
Polaromonas sp. JS666
Bpro_0760 groS -121 7.2 TTAGCACTCGATGGTATTGAGTGCTAA
Bpro_1256 rpoH -57 7 TTAGCACTCTCTCCAATGGAGTGCTAA
Rhodoferax ferrireducens DSM 15236
Rfer_1132 groS -130 7.2 TTAGCACTCGTAAGAGTTGAGTGCTAA
Rfer_1692 rpoH -58 7.1 TTAGCACTCTCTCTCATAGAGTGCTAA
Variovorax paradoxus S110
Vapar_1119 groS -110 7 TTAGCACTCGCTGCTGACGAGTGCTAA
Vapar_4379 rpoH -55 6.9 TTAGCACTCCCTCCAATCGAGTGCTAA
Verminephrobacter eiseniae EF01-2
Veis_4476 rpoH -72 6.6 TTGGCACTCGATCGCAGAGAGTGCTAA
Veis_2566 groS -110 6.8 TTAGCACTCTCCGCTGGGGAGTGCTAA
Methylibium petroleiphilum PM1
Mpe_A3171 rpoH -54 7.2 TTAGCACTCGTTTTACGTGAGTGCTAA
Mpe_A0427 groS -129 6.3 CTAGCACTCGCGCAGACTGAGTGCTAA
Leptothrix cholodnii SP-6
Lcho_3542 rpoH -59 6.9 TTAGCACTCTCGAGGGTCGAGTGCTAA
Lcho_0482 groS -96 6.5 TTAGCACTCGCCGGTGGTGAGTGCTAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD