Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Burkholderia

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSL0504 rpoH -88 7.2 TTAGCACTCCAGTAGACGGAGTGCTAA
BPSL2698 groS -103 7.9 TTAGCACTCGCTGCACGAGAGTGCTAA
Burkholderia mallei ATCC 23344
BMA3138 rpoH -88 7.2 TTAGCACTCCAGTAGACGGAGTGCTAA
BMA2002 groS -103 7.9 TTAGCACTCGCTGCACGAGAGTGCTAA
Burkholderia sp. 383
Bcep18194_A6145 rpoH -90 7.2 TTAGCACTCGTCTTGCGGGAGTGCTAA
Bcep18194_A3954 groS -100 7.9 TTAGCACTCGCTGCACGAGAGTGCTAA
Burkholderia cepacia AMMD
Bamb_2875 rpoH -89 7.5 TTAGCACTCGGATTCCGGGAGTGCTAA
Bamb_0732 groS -100 7.9 TTAGCACTCGCTGCACGAGAGTGCTAA
Burkholderia vietnamiensis G4
Bcep1808_2920 rpoH -28 7.6 TTAGCACTCGGATTACGGGAGTGCTAA
Bcep1808_0793 groS -100 7.9 TTAGCACTCGCTGCACGAGAGTGCTAA
Burkholderia glumae BGR1
bglu_1g31450 rpoH -85 7.9 TTAGCACTCTCCTGACGAGAGTGCTAA
bglu_1g07140 groS -98 7.9 TTAGCACTCGCTGCACGAGAGTGCTAA
Burkholderia xenovorans LB400
Bxe_A4146 rpoH -100 7 TTAGCACTCGGCAAATCAGAGTGCTAA
Bxe_A3816 groS -99 7.9 TTAGCACTCGCTGCACGAGAGTGCTAA
Burkholderia phymatum STM815
Bphy_0301 rpoH -82 7.3 TTAGCACTCGGTAGATGAGAGTGCTAA
Bphy_2334 groS -100 7.6 TTAGCACTCACCGCACGAGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD