Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Xanthomonadales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Xylella fastidiosa 9a5c
XF0616 groS -75 6.9 TTAGCACTCATTACATAAGAGTGCTAA
Xanthomonas axonopodis pv. citri str. 306
XAC0541 groS -75 6.9 CTGGCAGTCGTCATGTACGAGTGCTAA
Xanthomonas campestris pv. campestris str. ATCC 33913
XCC0522 groS -77 7.1 CTGGCAGTCGTCACATACGAGTGCTAA
Stenotrophomonas maltophilia K279a
Smlt4215 groS -73 6.8 CTGGCACTCGCCTGGGGTGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD