Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Oceanospirillales/Alteromonadales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Alcanivorax borkumensis SK2
ABO_0633 groS -96 8 TTAGCACTCCACTCATGAGAGTGCTAA
ABO_2569 rpoH -71 8.1 TTAGCACTCTATTAATTGGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD