Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Alteromonadales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudoalteromonas haloplanktis TAC125
PSHAa0357 rpoH -60 8.1 TTAGCACTCTTAGGTAAAGAGTGCTAA
Pseudoalteromonas tunicata D2
PTD2_13624 rpoH -60 7.9 TTAGCACTCTCGATAAAAGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD