Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Ralstonia

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia solanacearum GMI1000
RSc0641 groS -117 7.2 TTGGCACTCGCCTGGAGGGAGTGCTAA
RSc0374 rpoH -70 7.4 TTAGCACTCATCCAGCCGGAGTGCTAA
Ralstonia pickettii 12J
Rpic_0578 groS -118 7.6 TTAGCACTCGCCGGGCAGGAGTGCTAA
Rpic_0230 rpoH -70 7.6 TTAGCACTCATCCGGTTGGAGTGCTAA
Ralstonia metallidurans CH34
Rmet_0615 groS -118 7.6 TTAGCACTCGCTGGGGGAGAGTGCTAA
Rmet_0272 rpoH -96 7.7 TTAGCACTCGTCCGGTTCGAGTGCTAA
Ralstonia eutropha JMP134
Reut_A2657 groS -130 7.8 TTAGCACTCGCTGGGGGTGAGTGCTAA
Reut_A0325 rpoH -104 7.9 TTAGCACTCACCCGGCTTGAGTGCTAA
Ralstonia eutropha H16
H16_A0705 groS -121 7.8 TTAGCACTCGTCAGGGGTGAGTGCTAA
H16_A0354 rpoH -104 7.9 TTAGCACTCACCCGGCCTGAGTGCTAA
Cupriavidus taiwanensis
RALTA_A0685 groS -121 7.7 TTAGCACTCGTCAGGGGGGAGTGCTAA
RALTA_A0299 rpoH -108 7.7 TTAGCACTCACCCGGCCAGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD