Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AglR in Rhodobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Alpha-glucosides utilization
Effector: Alpha-glucoside; Maltose; Sucrose; Trehalose
Regulog: AglR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Jannaschia sp. CCS1
Jann_1945 aglR -31 5.8 AATTCCAAGCGCTTTGAAAG
Jann_1945 aglR -204 4.9 TTTTCAAAGCGCTTTGGGGT
Jann_1946 aglE -104 4.9 ACCCCAAAGCGCTTTGAAAA
Rhodobacterales bacterium HTCC2654
RB2654_03739 aglE -97 5.6 CATCCAAAACGGTTTGGAGC
RB2654_03744 aglR -170 5.6 GCTCCAAACCGTTTTGGATG
Oceanicola granulosus HTCC2516
OG2516_02419 aglE -96 6.1 CGTCCAAAGCGCTTTGATCC
OG2516_02414 aglR -194 6.1 GGATCAAAGCGCTTTGGACG
OG2516_02414 aglR -28 5.1 CTCCTAAAGCGCTTTGGAAG
Loktanella vestfoldensis SKA53
SKA53_03279 aglE -112 6.2 CATCCAAAGCGCTTTGGTAC
SKA53_03274 aglR -121 6.2 GTACCAAAGCGCTTTGGATG
Silicibacter TM1040
TM1040_3307 aglE -257 5.1 CCTCCAAAGCGCTTTAAAAA
TM1040_3307 aglE -102 6.3 CAATCAAAGCGCTTTGAATC
TM1040_3308 aglR -29 5.1 TTTTTAAAGCGCTTTGGAGG
TM1040_3308 aglR -184 6.3 GATTCAAAGCGCTTTGATTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD