Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AglR in Rhizobiales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Alpha-glucosides utilization
Effector: Alpha-glucoside; Maltose; Trehalose; Sucrose
Regulog: AglR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Agrobacterium tumefaciens str. C58 (Cereon)
Atu0590 aglR -76 5.5 AATCTAAAGCGCTTTGGGAA
Atu0590 aglR -233 6.1 CAATCAAAGCGCTTTGGCTA
Atu0591 aglE -221 5.5 TTCCCAAAGCGCTTTAGATT
Atu0591 aglE -64 6.1 TAGCCAAAGCGCTTTGATTG
Rhizobium etli CFN 42
RHE_CH00695 aglR -244 6.4 ATTTCAAAGCGCTTTGACAC
RHE_CH00695 aglR -81 5.7 AATTAAAAGCGCTTTGAGCG
RHE_CH00696 aglE -236 5.7 CGCTCAAAGCGCTTTTAATT
RHE_CH00696 aglE -73 6.4 GTGTCAAAGCGCTTTGAAAT
Rhizobium leguminosarum bv. viciae 3841
RL0744 aglR -256 6.3 ATTTCAAAGCGCTTTGACCC
RL0744 aglR -84 5.9 AATTGAAAGCGCTTTGGATG
RL0745 aglE -245 5.9 CATCCAAAGCGCTTTCAATT
RL0745 aglE -73 6.3 GGGTCAAAGCGCTTTGAAAT
RL3686 thuA -66 6.2 TTTCCAAAGCGCTTTGAATC
Sinorhizobium meliloti 1021
SMc03060 aglR -30 6.3 TATTCAAAGCGCTTTGGAAG
SMc03060 aglR -233 6.6 CATTCAAAGCGCTTTGAGTT
SMc03061 aglE -104 6.6 AACTCAAAGCGCTTTGAATG
Mesorhizobium loti MAFF303099
mll5113 aglE -138 6.2 AAGCCAAAGCGCTTTGGAAG
mlr5115 aglR -240 6.2 CTTCCAAAGCGCTTTGGCTT
mlr5115 aglR -21 5.4 ATTTAAAAGCGCTTTGAGGG
Mesorhizobium sp. BNC1
Meso_2855 aglE -105 6.2 TTCTCAAAGCGCTTTGAGCT
Meso_2854 aglR -127 6.2 AGCTCAAAGCGCTTTGAGAA
Rhizobium sp. NGR234
NGR_c03090 aglR -30 6.2 TATCCAAAGCGCTTTGAGAG
NGR_c03090 aglR -235 6.5 TATTCAAAGCGCTTTGAGTT
NGR_c03100 aglE -83 6.5 AACTCAAAGCGCTTTGAATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD