Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DVU0118 in Desulfovibrionales

Properties
Regulator family: Fis
Regulation mode:
Biological process:
Effector:
Regulog: DVU0118 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris Hildenborough
DVU0123 null -166 6.3 ATGTTCCCTCAAAGGAACAT
Desulfovibrio vulgaris str. Miyazaki F
DvMF_1255 null -163 6.4 ATGTTCCCGAATGGGAACAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD