Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DVU0309 in Desulfovibrionales

Properties
Regulator family: LysR
Regulation mode:
Biological process:
Effector:
Regulog: DVU0309 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfohalobium retbaense DSM 5692
Dret_0354 null -184 5.3 CCTATCAGAAATTTTGATAGC
Dret_0355 null -418 5.3 GCTATCAAAATTTCTGATAGG
Desulfovibrio desulfuricans G20
Dde_0349 null -34 5.7 TCTATCTAATTTTGTGATAGA
Dde_0349 null -67 4.4 ACTATCACATTGAGTGAGGGT
Dde_0348 COG4125 -213 4.4 ACCCTCACTCAATGTGATAGT
Dde_0348 COG4125 -246 5.7 TCTATCACAAAATTAGATAGA
Desulfovibrio salexigens DSM 2638
Desal_3365 COG4125 -52 5 CCAAACTGAATAAAAGATTGA
Desal_3365 COG4125 -84 5.2 CCTATCTTGTTTTAAGATTGT
Desal_3366 null -63 5 TCAATCTTTTATTCAGTTTGG
Desal_3366 null -31 5.2 ACAATCTTAAAACAAGATAGG
Desulfovibrio vulgaris Hildenborough
DVU0309 null -61 5.1 TCTATCTGGAAGACGGATTGA
DVU0309 null -28 5.7 TCTATCTGAAAAACAGATGGA
DVU0308 COG4125 -85 5.7 TCCATCTGTTTTTCAGATAGA
DVU0308 COG4125 -52 5.1 TCAATCCGTCTTCCAGATAGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD