Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Thermoanaerobacterales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Thermoanaerobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caldicellulosiruptor saccharolyticus DSM 8903
Csac_0794 ribD -248 114.9 GTCCATCCTTCGGGGCGGGGTGAAATTCCCCACTGGCGGTAAAAGCCCGCGAGCAAAAGCCTTTCTGGCTTTTGCAGAACCGGTGGAATTCCGGTGCCAACGGTTACAGTCCGGATGGGAGAAGGAATGG
Moorella thermoacetica ATCC 39073
Moth_0915 ribD -273 115.1 ACGTCCTTCGGGGTTAGGTGTAATTCCTTACCGGCGGTAAAGCCCGCGAGCCGTTATGGCAGACCCGGTGAAATTCCGGGGCCGACAGTAAAAGTCTGGAAGGGAGAAGGAGGTTAT
Thermoanaerobacter tengcongensis MB4
TTE0534 ribU -217 121.3 AAAATCTTCGGGGCAGGGTGGAATTCCCGACCGGCAGTGAAAGCCTGCGAGCCGCATATGCGGTTGACTCGGTGAAATTCCGAGGCCGACGGTAAAAGTCCGGATGGGAGAAGATTTACTT
Thermoanaerobacter ethanolicus X514
Teth514_0486 ribU -209 117.5 TAAATCTTCGGGGCAGGGTGAAATTCCCGACCGGCGGTATAGCCCGCGAGCCGCGCATGCGGTCGATTTGGTGAAATTCCAAAGCCGACAGTGAAAGTCTGGAGGGGAGAAGATTTTCTT
Teth514_0020 ribD -199 113.7 AAAACCTTCAGGGATCGGTGAAATTCCGTACCGGCGGTATAGCCCGCGAGCCTTTTGGCAGACTCGGTGAAATTCCGAGGCCGACAGTTAAAGTCTGGATGGGAGAAGGAGAAATA
Anaerocellum thermophilum DSM 6725
Athe_0564 ribD -252 114.5 GTCCATCCTTCGGGGCGGGGTGAAATTCCCCACTGGCGGTAAAAGCCCGCGAGCAAAAGCCTTTCTGGCTTTTGCAGAACCGGTGGAATTCCGGTGCCAACGGTTACAGTCCGGATGGGAGAAGGAGTGG
Thermoanaerobacter italicus Ab9
Thit_0536 ribU -209 120.1 TAAATCTTCGGGGCAGGGTGAAATTCCCGACCGGCGGTATAGCCCGCGAGCCGCTTAGGCGGTTGATGTGGTGAAATTCCACAGCCGACAGTGAAAGTCTGGAGGGGAGAAGATTTTGTT
Thit_0021 ribD -198 113.7 AAAACCTTCAGGGATCGGTGAAATTCCGTACCGGCGGTATAGCCCGCGAGCCTTTTGGCAGACTCGGTGAAATTCCGAGGCCGACAGTTAAAGTCTGGATGGGAGAAGGAGAAATA
Carboxydothermus hydrogenoformans Z-2901
CHY_1475 ribD -196 119.8 TTACTACCTTCGGGGTCAGGTGGAATTCCTAACCGGCGGTAAAGCCCGCGAGTCCGTAAAAATTTACGGATAGATCCGGTGAAATTCCGGAGCCGACAGTTAAAGTCTGGATGGGAGAAGGTATTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD