Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Streptomycetaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_6902 ribE -279 92 AGCGCACTCCGGGGTCGGTGAAAGTCCGAACCGGCGGTTATAGTCCGCGACCCGCTCGCCTCGGCGATCGGTTGACCAGGTGGAATTCCTGGACCGACGGTTAAAGTCCGGATGGGAGGCAGTGCGCGGCG
Streptomyces scabiei 87.22
SCAB_75601 ribE -285 90 AGCGCACTCCGGGGTCGGTGAAAGTCCGAACCGGCGGTTACAGTCCGCGACCCGGTCGCTTCCAGCGGCCGGTTGACCAGGTGAAATTCCTGGACCGACGGTTAAAGTCCGGATGGGAGGCAGTGCGCGGCG
Streptomyces coelicolor A3(2)
SCO1443 ribE -280 89.8 GCAGCGCACTCCGGGGTCGGTGAAAGTCCGAACCGGCGGTTACAGTCCGCGACCCGGTCGCCTCCAGCGACCGGTTGACCAGGTGAAATTCCTGGACCGACGGTTAAAGTCCGGATGGGAGGCAGTGCGCGG
Streptomyces griseus subsp. griseus NBRC 13350
SGR_6089 ribD -303 85.8 AGCGCACTCCGGGGTCGGTGCAATTCCGAACCGGCGGTTATAGTCCGCGACCCGTCCGCAGCCAGCGGCCGGTTGACCAGGTGAGATTCCTGGACCGACGGTGAAAGTCCGGATGGGAGGCAGTGCGCGGCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD