Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Bifidobacteriaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Bifidobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bifidobacterium angulatum DSM 20098
BIFANG_00999 ribU -177 83.4 CCGTAAGTTTCAGGGAAGGTGAAATTCCTTACTGGCGGTAAGTCGGCGCCCGGCATTCATAACGGAGCGCACGGCAAGCCCGCGACCCGCGCAAGCGGCCGATTCGGTGCGATTCCGAAGCCAACGGTACAGTCCGGATGGAAGAAACGAGGA
Bifidobacterium bifidum NCIMB 41171
BbifN4_010100002939 ribU -159 73.1 AAGCAAGTTTCAGGGAAGGTGCAATTCCTTACTGGCGGTGACCTGCGGAGCCGGGATTCATAACGGCGGCCGCGGCAGCCCGCGACCCGCGCAAGCGGCTGATCCGGTGGGAATCCGGAGCCAACGGTCAAAGTCCGGATGGAAGAAACGGAGC
Gardnerella vaginalis 409-05
HMPREF0424_0823 ribU -152 97.3 GTTAGTTTCAGGGAAGGTGAAAATCCTTACTGGCGGTAACAAAATACGTATTTCATGCGTTTTTGAAGCCCGCGAGCGGCTTACAAGCTGCTGATTCGGTTAAATTCCGAAGCCAACGGTTACAGTCCGGATGAAAGAAACGGAGACC
Bifidobacterium breve DSM 20213
BIFBRE_00572 ribU -138 88.2 CTGTCAGTTTCAGGGAAGGTGTAATTCCTTACTGGCGGTGATCTGCACTCCGGGTTTCATAACGGAGATGTCAGGAAGCCCGCGACCCGCGTAAGCGGCTGATCCGGTGAGATTCCGGAGCCAACGGTTATAGTCCGGATGGAAGAAACGAGGG
Bifidobacterium adolescentis ATCC 15703
BAD_0962 ribU -222 81 AAGCAAGTTTCAGGGAAGGTGAAAATCCTTACTGGCGGTAACGGCACGACCGGCATTCATAACGGCCCCATACCGAAGCCCGCGACCCGCGAAAGCGGCTGATCCGGTGAGAATCCGGGGCCAACGGTTACAGTCCGGATGGAAGAAACGGAGC
Bifidobacterium longum NCC2705
BL0044 ribU -159 88.7 CTGTCAGTTTCAGGGAAGGTGCAATTCCTTACTGGCGGTAACCTGCACCCCGGGTTTCATAACGGGGATGGCAGGAAGCCCGCGACCCGCGCAAGCGGCTGATCCGGTGAGATTCCGGAGCCAACGGTATAGTCCGGATGGAAGAAACGAGGG
Bifidobacterium gallicum DSM 20093
BIFGAL_01827 ribU -137 81.8 CATAGTTTCAGGGAAGGTGCAATTCCTTACTGGCGGTAACGCTAGGCCGGGTCCATAACCGGTATTCGACGCGAAGCCCGCAACCCGCATGACGCGGTTGATCCGGTGTGAATCCGGGGCCAACGGTTACAGTCCGGATGGAAGAAACGGAAGGT
Bifidobacterium dentium Bd1
BDP_1337 ribU -157 76.8 ACAAGTTTCAGGGAAGGTGAAAACCCTTACTGGCGGTAACGGTGAAACCGATGACCATAACGGCCCACCACCGAAGCCCGCGACCCGCGAATGCGGCTGATCCGGTGAGAATCCGGGGCCAACGGTCAAAGTCCGGATGGAAGAAACGGAGCTC
Bifidobacterium animalis subsp. lactis AD011
BLA_1217 ribU -148 75 AGTGCAATTTCAGGGAAGGTGAAACTCCTTACTGGCGGTAGCGCAACGGGCCCGTGCCCGCATGCGGAGCCCGCAACCCGCGCAAGCGGTGGATCTGGTGCGAGTCCAGGGCCAACGGTTATAGTCCGGATGAAAGAAATGAGCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD