Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Francisellaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Francisellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Francisella tularensis subsp. tularensis SCHU S4
FTT_1671 ribD -269 128.4 ATAATCTTCAGGGCAGGGCGAAATTCCCTACCGGCGGTAACTGCTTATAGCAGAAGCCCGCGAGCGCTTTCTAATAAAAATAGAGAGGTCAAGCAGATTTGGTGTAATTCCAAAGCCGACAGTTAAAGTCTGGATGAAAGAAGATTGAGGA
Francisella philomiragia subsp. philomiragia ATCC 25017
Fphi_0713 ribD -256 128 ATAATCTTCAGGGCAGGGCGAAATTCCCTACCGGCGGTAACTGTCTAATCACAGAAGCCCGCGAGCGCTTTTTAGATATTAAAAAGGTCTAGCAGATTTGGTGCAACTCCAAAGCCGACAGTATAGTCTGGATGAAAGAAGATGGAAGA
Francisella novicida FTE
FTE_0404 ribD -271 128.3 AAATAATCTTCAGGGCAGGGCGAAATTCCCTACCGGCGGTAACTGCTTATAGCAGAAGCCCGCGAGCGCTTTCTAATAAAAATAGAAAGGTCAAGCAGATTTGGTGTAATTCCAAAGCCGACAGTTACAGTCTGGATGAAAGAAGATTGAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD