Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Clostridia-3

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Clostridia-3
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides pectinophilus ATCC 43243
BACPEC_00730 ribU -213 64.1 GAATGAACGGCAGATTCAATTCTTGACCGGCGGTATAGTCCGCGAACCTCGTATAAGAGGCCGATTGGGTTTGACTCCCAAACCGACAGTATAGTCTGGATGAAAGAAGTGTAGG
Blautia hansenii DSM 20583
BLAHAN_02906 ribD -289 119.8 ATAAAATCTTCAGGGCAGGGTGCAATTCCCTACCGGTGGTATAGCCCACGAGCCGCAAGGCATGATTCGGTGAAACTCCGAAGCCGACAGTATAGTCTGGATGAAAGAAGATTAAG
BLAHAN_01242 ribU -211 117.8 AGAAATTCTTCGGGGCAGGGTGCAATTCCCTACCGGCGGTTATAGTCCGCGAGCCGTATAAAACGGTTGAATTGGTGCAATTCCAATACCGACAGTATAGTCTGGATGAGAGAAGAAAGAA
Bryantella formatexigens DSM 14469
BRYFOR_03730 ribU -202 114.9 GAAATCTTCGGGGCAGGGTGAAATTCCCTACCGGCGGTATAGTCCGCGACCCGCTTCGGCGGCTGAATTGGTGTAATTCCAATACCGACAGTACAGTCTGGATGAGAGAAGATGGAACA
Dorea longicatena DSM 13814
DORLON_02764 ribD -280 111.5 ACGAAATCTTCAGGGCAGGGTGCGATTCCCTACCGGCGGTAAAGCCCGCGGGCCGAGAGGCATGATCCGGTGTGATTCCGGAGCCGACAGTATAGTCTGGATGAAAGAAGATGATG
DORLON_02252 ribU -315 101.3 AGATTCTTCGGGGCAGGGTGTGATTCCCAACCGGCGGTAAAGTCCGCGAACTGGTCATTTGAAGAATTTCTGGTCAGAGATATCTGAACAGATGTTATCAATGTGATGATCAGCCGATTTGGTGAGATTCCAGAACCGACAGTAAAGTCTGGATGAGAGAAGGATGATAC
Dorea formicigenerans ATCC 27755
DORFOR_00288 ribD -288 113 GAAATCTTCAGGGCAGGGTGAGATTCCCTACCGGCGGTAAAGCCCGCGAGCCGAGAGGCATGATTCGGTGAGATTCCGAAGCCGACAGTATAGTCTGGATGAGAGAAGAAGACGGT
DORFOR_03135 ribU -348 119.8 AGAGATTCTTCGGGGCAGGGTGTAATTCCCAACCGGCGGTAAAGTCCGCGACCCGCTGTGTAAGTGTATGCAGTGGCTGATCTGGTGAGATTCCGGAACCGACAGTAAAGTCTGGATGAGAGAAGAATTAT
Ruminococcus gnavus ATCC 29149
RUMGNA_02978 ribU -272 97.4 AATAAATCTTCGGGGTCGGGTGTAAGTCCCAACTGGCGGTAAAGTCCGCGACCTGTTTTCTGCTAAGAGTGGAGGATGGCTGAACCGGTGATCTGCAGATCAGAAATTCCGGTACCAACAGTAAAGTCTGGATGAAAGAAGATGTAT
Ruminococcus lactaris ATCC 29176
RUMLAC_02357 ribU -312 92.5 GTAATCTTCGGGGTCGGGTGAAAGTCCCAACCGGCGGTATAGTCCGCGACCCGCAGTATCTGCGGCTGAACCGGTGACTTTTCTGTGCAAAGGATGCATGGCAGGGGATTCCGGTACCGACAGTAAAGTCTGGATGAGAGAAGAAGGTTCG
Roseburia intestinalis L1-82
ROSINTL182_01713 ribU -152 88.5 TAATTCTTCGGGGCAGGGTGATGCAGTAAGATTTGCAGATTCCCGACCGACGGTGATGTAGAGTCCTGATAATGATCAGAGTCATTTACAAAGTCCGTGACCTGCTAAGGCAGCTGATCCGGTGAGATTCCGGAACCGACAGTATAGTCTGGATGAGAGAAGATAAGCAT
ROSINTL182_02839 ribD -384 114.5 ATGATCTTCAGGGCAGGGTGTGATTCCCTACCGGTGGTATAGCCCACGAGCCGTAAGGCATGATTCGGTGTAATTCCGAAGCCGACAGTATAGTCTGGATGAAAGAAGATATGGAT
Eubacterium rectale ATCC 33656
EUBREC_3132 ribD -345 107.5 AATTATTCTTCAGGGCAGGGTGCAATTCCCTACCGGTGGTATAGCCCACGAGCCGCAAGGCATGATTTCGGTGAGATTCCGAAGCCGACAGTAAAGTCTGGATGAAAGAAGATGTGA
EUBREC_0834 ribU -244 110.3 GAATTCTTCAGGGCAGGGTGAGATTCCCTACCGGTGGTACAGCCCACGAGCCGCAAGGCATGATTCGGTGTGATTCCGAAGCCGACAGTATAGTCTGGATGAGAGAAGATTATTAG
Eubacterium eligens ATCC 27750
EUBELI_20114 ribD -847 109.3 TATGGAACTTCAGGGCAGGGTGTGATTCCCTACCGGTGGTAAAGCCCACGAGCCGAGGCGTAAGCCAGAGCATGATTCGGTGTAATTCCGAAGCCGACAGTAAAGTCTGGATGAAAGAAGTGATAT
Clostridium scindens ATCC 35704
CLOSCI_02146 ribU -142 109.6 AGAGATTCTTCGGGGTCGGGTGCAAATCCCAACCGGCGGTATAGTCCGCGACCCGGCGCGTTTATCCGCGCTGGCTGATCTGGTGCAATTCCGGAACCGACAGTAAAGTCTGGATGAGAGAAGAATTAT
CLOSCI_02942 ribU -192 91.4 GAAGTCTTTGTGGCAGGGTGCAAATCCCTACCGATGGTATAGTCCATGACCCGCGCAAGCGGCTGATCTGGTGACCTTTTTGAGGAATTCCAGAACCGACGGTATAGTCCGGATGAGAAAAGACATTTTC
Clostridium nexile DSM 1787
CLONEX_02849 ribU -239 113.4 GGATTCTTCGGGGCAGGGTGTAATTCCCTACCGGCGGTTACAGTCCGCGACCCATGAAAATGGCTGAACTGGTGGAATTCCAGTACCGACAGTAAAGTCTGGATGTGAGAAGAAGGTGTG
Clostridium bolteae ATCC BAA-613
CLOBOL_02805 ribD -688 117.1 AATATCTTCAGGGCAGGGTGCAATTCCCTACCGGTGGTACAGCCCACGAGCCGCAAGGCATGATTCGGTGAAACTCCGAAGCCGACAGTACAGTCTGGATGAAAGAAGATGGAACG
CLOBOL_02256 ribU -352 114.4 TAAAGTTCTTCGGGGCAGGGTGTGATTCCCTACCGGCGGTAATAGTCCGCGACCCGCTACGGCGGCTGATCTGGTGTGATTCCAGAACCGACAGTATAGTCTGGATGAGAGAAGAAGGTG
Clostridiales bacterium 1_7_47_FAA
Cbac1_010100006733 ribD -499 113.7 AATATCTTCAGGGCAGGGTGCGATTCCCTACCGGTGGTACAGCCCACGAGCCGCAAGGCATGATTCGGTGTGATTCCGAAGCCGACAGTATAGTCTGGATGGAAGAAGATGGACAT
Cbac1_010100023592 ribU -127 108.1 ATAAGTTCTTCGGGGCAGGGTGTGATTCCCTACCGGCGGTATAGTCCGCGACCCGCTTAGGCGGCTGATTTGGTGAGATTCCAAAACCGACAGTATAGTCTGGATGAGAGAAGGCGATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD