Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Desulfuromonadales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Desulfuromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pelobacter propionicus DSM 2379
Ppro_0312 null -265 112.3 CTTATTCTCAGGGCGGGGTGAAATTCCCCACCGGCGGTATCCCGGTCTTTCCGGGGAGCCCGCGAGCGCCCCTTCCAGCATGAAGGGGGTCAGCAGATCTGGTGCGATGCCAGAGCCGACGGTTACAGTCCGGATGAAAGAGGATACGGCA
Pelobacter carbinolicus str. DSM 2380
Pcar_0884 ribB -244 105.7 GTAAAGTTCTCAGGGCGGGGTGAAAGTCCCCACCGGCGGTGATGTTGCCATCGAGCAAACAAGCCCGCGAGCGCCTGCCGTATAGCAGGGCCAGCAGACCCGGTTGGAATCCGGGGCCGACGGTTAGAGTCCGGACGAGAGAGAATGCTT
Desulfuromonas acetoxidans DSM 684
Dace_1777 null -228 124.6 CCTATTCTCAGGGCGGGGTGAAATTCCCCACCGGCGGTGACTCCTTGTGAGAAGCCCGCGAGCGCCTTTATTATTGGGATAAAGGGTCAGCAGATCTGGTGAGATTCCAGAGCCGACGGTTATAGTCCGGATGAAAGAGGATATTCAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD