Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Rhodospirillales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodospirillum rubrum ATCC 11170
Rru_A2197 ribB -304 110.1 CTTGTTCTCAGGGCAGGGTGAAACTCCCGACCGGCGGTAATCCTTCCCTTTCACGGGGGGGACAGCCCGCGAGCGCCCTTTGCCGGTGGTGAAGGGGTCCAGCAGATCCGGTGCGAAGCCGGAGCCGACGGTATAGTCCGGATGGAAGAGAACGAGGTG
Gluconacetobacter diazotrophicus PAl 5
Gdia_1867 ribD -319 97.7 TTGACGTTCTCGGGGCGGGGTGAAAGTCCCCACCGGCGGTATTTGCGCCCGGTCATCAGGCCGGGGTGCATCAGCCCGCGAGCGCCCGCCAGGCCTTTGGGCATGGCGGGGACAGCAGATCCGGTGTGATTCCGGAGCCGACGGTTACAGTCCGGATGATAGAGAACGATG
Acetobacter pasteurianus IFO 3283-01
APA01_18580 ribD -247 120.4 GTGATGTTCTCAGGGCAGGGTGAAAATCCCTACCGGCGGTAAGCAGCGCACAGCGTTGTAAGCCCGCGAGCGCCCGCTTATGGCGGGGTCAGCAGATCCGGTGCAATTCCGGGGCCGACGGTTACAGTCCGGATGGAAGAGAACAGAA
Gluconobacter oxydans 621H
GOX0978 ribD -274 113.1 GACGTTCTCAGGGCGGGGTGAAATTCTCCACCGGCGGTATTGGCGGATTTCTCCGCCTCAGCCCGCGAGCGCCTTCCGGATTTCGGTTCGGAAGGGACAAGCAGATCCGGTGAGACTCCGGAGCCGACGGTTAGAGTCCGGATGGAAGAGAACGCAGCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD