Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Various betaproteobacteria

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chromobacterium violaceum ATCC 12472
CV4216 ribB -279 110.4 TACGTCTTCGGGGCGGGGTGCAACTCCCCACCGGCGGTATGGCGCGCAAGCGCCGAGCCCGCGAGCGCCTTTGCCTGACGGCAAAGGGTCAGCAGATCTGGTGAAACGCCAGAGCCGACGGTAATAGTCCGGATGAGAGAAGACGACGCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD