Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Comamonadaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax sp. JS42
Ajs_2261 ribB -319 72 GGCAGGTCTTCAGGGCGGGGTGGAATTCCCCACCGGCGGTAGGCGGCGCATGGAGGTTTTCTTGCACCGCGAGCCCGCGAGCGCCCCGGTTGCCATCAGTGCAACCGGGGGTCAGCAGACCCGGTGCGGGGCGGCGCAGGCCACTCCCAGTCCGGGGCCGACGGTCATAGTCCGGATGAAAGAAGACGTGC
Comamonas testosteroni KF-1
CtesDRAFT_2527 ribH2 -203 101.7 GCAGCGTTCTCAGGGCGGGGTGCAATTCCCCACCGGCGGTATCTGCGGCAATGCCTTGCATTGACTGCAGCAGCCCGCGAGCGCCTGCAGTCTCGCCAGAGCCTGCAGGGTCAGCAGATCTGGTGAGATGCCAGAGCCGACGGTCATAGTCCGGATGAAAGAGATCGCGC
Delftia acidovorans SPH-1
Daci_2196 ribH2 -277 92.2 AGCGTTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTATCTGGATCTGCCTTTCGGCATGTGTCCAGCAGCCCGCGAGCGCCCGGCAAGCCGCAAGGCCGGCCGGGGTCAGCAGATCTGGTGAGATGCCAGAGCCGACGGTCACAGTCCGGATGAAAGAGATCGCGCAG
Variovorax paradoxus S110
Vapar_1854 ribH2 -266 91.1 CAAGCGTTCTCAGGGCGGGGCGAAACTCCCCACCGGCGGTAATGGCGGCTTCTTCGAAAGAGGGGCCGCACGAGCCCGCGAGCGCCCAAGGCCTGCAATGGGCTGCGGGGTCAGCAGATTTCGGTGCAATTCCGAAGCCGACGGTCACAGTCCGGATGAAAGAGAGCGCGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD