Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Xanthomonadales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Xanthomonas axonopodis pv. citri str. 306
XAC0748 ribE -346 96 AACGTCTTCAGGGCGGGGTGCGATTCCCCACCGGCGGTAGGCATGCGCAAGCATGCGAGCCCGCGAGCGCTTGCACTCCAGGGTTGAGCGGACTAACGCCAAACCCCTGCTGCGCAAGGTCAGCAGATCCGGTCCGATGCCGGAGCCGACGGTATAGTCCGGATGAAAGAAGACGGCCAC
Xanthomonas campestris pv. campestris str. ATCC 33913
XCC0695 ribE -336 101.2 AACGTCTTCAGGGCGGGGTGCGATTCCCCACCGGCGGTATGCATGCGCAAGCGTGTGAGCCCGCGAGCGCTTCGCTGCCGATCTCTCGCTGAGAGCACGGCGGTGAAGGTCAGCAGATCCGGTGCGATGCCGGGGCCGACGGTATAGTCCGGATGAAAGAAGACGGCCAA
Stenotrophomonas maltophilia K279a
Smlt0727 ribE -219 104.8 AACGTCTTCAGGGCGGGGTGCAATTCCCCACCGGCGGTAGGTGCGCAAGCACGAGCCCGCGAGCGCCCCGGCCCACGGCCGGGGGTCAGCAGATCCGGTCCAATGCCGGAGCCGACGGTCATAGTCCGGATGAAAGAAGACGGTGCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD