Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Moraxellaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Moraxellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acinetobacter sp. ADP1
ACIAD2913 ribB -239 111.8 ATCGCTTCAGGGCGGGGCGTAATTCCCCACCGGCGGTAAGCTCAACACGAGCAAGCCCGCGAGCAATTGGACCATTTAATGGCGTCAATCGCAGATCTGGTGTAAATCCAGAGCCGACGGTATAGTCCGGATGAAAGAAGACGACGTT
Acinetobacter baumannii AB0057
AB57_0876 ribB -242 118.5 CCATCGCTTCAGGGCGGGGTGTAATTCCCCACCGGTGGTAAAGTTAATTTTTATTGTTAAATTAACAAGCCCACGAGCTTAAATTATGTAATTTGAGCAGATTTGGTGAAACTCCAAAGCCGACGGTATAGTCCGGATGAAAGAAGACGACG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD