Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Oceanospirillales/Alteromonadales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Hahella chejuensis KCTC 2396
HCH_01388 ribB -132 116.8 AACTTATTCTCAGGGCAGGGTGAAATTCCCTACCGGCGGTATGTCCCCCGTGGACGAGCCCGCGAGCGCCTGCTGCAGTACAGCAGGGTCAGCAGATCCGGTGAGAGGCCGGAGCCGACGGTGACAGTCCGGATGGGAGAGAATAAGG
Marinomonas sp. MWYL1
Mmwyl1_1372 ribH -284 121.1 ACTTCGTTCTCGGGGCGGGGTGTAATTCCCCACCGGCGGTAAAGACTTTACATAAGTTAAATTCTAAGCCCGCGAGCGCCTTCAAGAAACTTTTCTTTTAGGGTCAGCAGATCTGGTGTAATTCCAGAGCCGACGGTTATAGTCCGGATGATAGAGAGCGCGT
Mmwyl1_0168 emrE -295 106.5 TCGAACTTCGGGGCGGGGCGAAATTCCCCACCGGCGGTGATTTGCTTGATTGAATAATCCAGTAAACAGCCCGCGAGCGCCTTGTTGCTTAAAGATATGTCTTTTTAGCAACAAGGGTCAGCAGATCTGGTGAGACTCCAGAGCCGACGGTTACAGTCCGGATGATAGAAGATCGACCA
Reinekea sp. MED297
MED297_12482 emrE -323 25.1 GTTGTTTTTGTCAGGAGCCCACGAGCGCCCGAGTCGCCATTCTGGTGGCCCGGGGTCTAGCAGATCAGGTGCGCAAGACAGGCAATCTAAGGATTGGTTGATCGTGCAAGGCCTGAGCCGACGGTGATAGTCCGGATGGAAGAAGTTAACGCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD