Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Psychromonadaceae/Aeromonadales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Psychromonas sp. CNPT3
PCNPT3_11584 ribB -251 117.4 ACTATTCTCAGGGCGGGGTGAGATTCCCCACCGGTGGTAATTTGTAAAACGTTACAACAGCCCACGAGCGCTTTATATTGAAAAATATAAAGGTCAGCAGATCCAGTGAAAACCTGGAGCCGACGGTTAAAGTCCGGATAAAAGAGAATGAATAT
Moritella sp. PE36
PE36_19425 ribB -380 37.8 ATAATTCTCAGGGCGGGGTGTAATTCCCCACCGGCGGTAATAATAAGGTATATGATTCATTAAGATGCAATCGTATTCCTATTTCAGCCCGCGAGCGCCTAAGCTATCTATTATTAATACAGTTATCTG
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_1311 ribB -259 110.2 CTTATTCTCAGGGCGGGGTGAAATTCCCCACCGGCGGTATCCCGATGTGACTCGGGGAGCCCGCGAGCGCCCGACCCGGTATTGCACCGGGACGGGGTCAGCAGATCCGGTGAGATGCCGGAGCCGACGGTCATAGTCCGGATGAAAGAGGATAAGACA
Aeromonas salmonicida subsp. salmonicida A449
ASA_1293 ribB -263 111.8 CTTATTCTCAGGGCGGGGTGCAATTCCCCACCGGCGGTATCCCGATCTGACTCGGGGAGCCCGCGAGCGCCCGACTTTGGTTTCACACCTGAGTCGGGGTCAGCAGATCCGGTGAGATGCCGGAGCCGACGGTCATAGTCCGGATGAAAGAGGATAAGACA
Tolumonas auensis DSM 9187
Tola_1102 ribB -242 119.5 AGCATATTCTCAGGGCGGGGTGAAAGTCCCCACCGGCGGTAAACAGTCTGAAGAGGTCTTCAACTGAAAGCCCGCGAGCGGTTGATGCGTTTTATGACGTATTGATGTCAGCAGATCCGGTGTAATTCCGGAGCCGACGGTTATAGTCCGGACGGAAGAGGATACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD