Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Alteromonadales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudoalteromonas haloplanktis TAC125
PSHAa1233 ribB -338 110.7 TACATTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTATGTTTAATTCACTATTTTAATTACATTTGTAGTGTTTAAATAAGCCCGCGAGCGCTTTGTTGTTTTATATAATATCAAAGGTCAGCAGATCTGGTGAGATGCCAGAGCCGACGGTTACAGTCCGGATGAAAGAGAATATGGCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD