Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Caur_1157 in Chloroflexia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: Caur_1157 - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus sp. Y-400-fl
Chy400_1181 Caur_1157 -117 5.6 GACTGGAAGCGCTTTCACGG
Chloroflexus aggregans DSM 9485
Cagg_1685 Caur_1157 -119 5.6 CCCTGGAAGCGCTTTCACGG
Herpetosiphon aurantiacus ATCC 23779
Haur_0297 Caur_1157 -347 6 CATTGAGACCGCTCCCAATG
Haur_0297 Caur_1157 -271 5.7 GAATGAGATCGCTCCCAAGC
Haur_0296 bglA -207 5.7 GCTTGGGAGCGATCTCATTC
Haur_0296 bglA -131 6 CATTGGGAGCGGTCTCAATG
Haur_1418 null -41 5.2 TATTGAGACCGATTCCAATG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD