Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Caur_3448 in Chloroflexia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Caur_3448 - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_0275 Caur_3448 -57 6 CTACTTAACCGATTAAGTGG
Cagg_0275 Caur_3448 -41 4.8 GTGGTTAATCGGTTAAGTTA
Chloroflexus sp. Y-400-fl
Chy400_3712 Caur_3448 -50 6 CCACTTAATCGATTAACCGC
Chy400_3712 Caur_3448 -34 5.5 CCGCTTAATCGTTTAACTAA
Herpetosiphon aurantiacus ATCC 23779
Haur_0778 Caur_3448 -32 5.7 CTATTTAAACGTTTAAATAG
Roseiflexus castenholzii DSM 13941
Rcas_1277 Caur_3448 -34 5.4 CCGCTTAACCGTTTCACCCC
Rcas_1277 Caur_3448 -18 4.4 CCCCTTAATCGTTTCACGAT
Roseiflexus sp. RS-1
RoseRS_0524 Caur_3448 -34 5.8 CCGCTTAATCGTTTCACCGC
RoseRS_0524 Caur_3448 -18 5.3 CCGCTTAATCGTTTCACCAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD