Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HTCS_Ara-1 in Bacteroidaceae

Properties
Regulator family: [Other]
Regulation mode: activator
Biological process: Arabinan utilization
Effector: Arabinan
Regulog: HTCS_Ara-1 - Bacteroidaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides cellulosilyticus DSM 14838
BACCELL_05304 abn2 -268 7.8 TGTCCACCTCAAATGTTCATTTGTCCACCT
Bacteroides dorei DSM 17855
BACDOR_01719 susC_Ara-3 -291 7.5 CGTCCACCCTATAAAACCGTTTGTCCACCC
BACDOR_01716 abn2 -159 7.4 TGTCCACCCTTTAAGCGATATTGTCCACCT
Bacteroides eggerthii DSM 20697
BACEGG_01542 abn2 -285 7.4 TGTCCACCTTAAAAGGTCATATATCCACCT
BACEGG_01540 susC_Ara-3 -328 7.3 TATCCACCTCTAAAACCCATTTGTCCACCC
BACEGG_01540 susC_Ara-3 -349 6.4 TCTCTACACTTAAAATTCGTTTATCCACCT
Bacteroides plebeius DSM 17135
BACPLE_00643 susC_Ara-3 -224 7.8 TATCCACCTATAAAATTCGTTTGTCCACCT
BACPLE_00641 abf2 -153 6.8 TGTCCACCCAATAGAAAAATTTGTCCACCT
Bacteroides thetaiotaomicron VPI-5482
BT0365 lamG -136 7.6 TATCCACCTCGAAAATTCATTTGTCCACCT
BT0367 abn2 -69 7 TGTCCACCAATCGTGTTCGTATGTCCACCT
Bacteroides vulgatus ATCC 8482
BVU_1005 susC_Ara-3 -265 7.5 CGTCCACCCTATAAAACCGTTTGTCCACCC
BVU_1002 abn2 -169 7.4 TGTCCACCCTTTAAGCGATATTGTCCACCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD