Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Clostridia-2

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Clostridia-2
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium hiranonis DSM 13275
CLOHIR_00054 groES -84 7.5 TTAGCACTCATAGTCTTAGAGTGCTAA
CLOHIR_02043 hrcA -42 7.4 TTAGCACTCTTAAACGATGAGTGCTAA
Clostridium difficile 630
CD0193 groES -136 7.1 TTAGCACTCTATTAGATAGAGTGATAA
CD2463 hrcA -47 7.2 TTAGCACTCGAACTTAGTGAGTGCTAA
Clostridium bartlettii DSM 16795
CLOBAR_00663 groES -93 7.4 TTAGCACTCTTACTTAAAGAGTGATAA
CLOBAR_02734 hrcA -20 7.3 TTAGCACTCGAAAATAGTGAGTGCTAA
CLOBAR_00615 COG0071 -233 6.8 TTAGCACTCTCCTATTGACAGTGCTAA
CLOBAR_00615 COG0071 -52 7.4 TTAGCACTCGATAACTTAGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD