Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Clostridia-1

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium acetobutylicum ATCC 824
CAC1280 hrcA -42 7.6 TTAGCACTCAAAGAGAGTGAGTGCTAA
CAC2704 groES -106 7.7 TTAGCACTCAAGATTAACGAGTGCTAA
CAC3315 htpG -116 7.7 TTAGCACTCGTTGATATAGAGTGCTAA
Clostridium beijerincki NCIMB 8052
Cbei_0828 hrcA -44 7.6 TTAGCACTCGAGGTTAATGAGTGCTAA
Cbei_0328 groES -75 7.6 TTAGCACTCGACAATGATGAGTGCTAA
Clostridium botulinum A str. ATCC 3502
CBO2961 hrcA -48 7.6 TTAGCACTCGTTGCTAGTGAGTGCTAA
CBO3299 groES -84 8.1 TTAGCACTCAATATTAATGAGTGCTAA
CBO1985 htpG -103 7 TTAGCACTCACTAGCTTAAAGTGCTAA
Clostridium butyricum 5521
CBY_3533 hrcA -44 7.6 TTAGCACTCGCTGCTAATGAGTGCTAA
CBY_3050 groES -84 7.7 TTAGCACTCGATGATGATGAGTGCTAA
Clostridium kluyveri DSM 555
CKL_0900 hrcA -42 7.6 TTAGCACTCAATGCTAGCGAGTGCTAA
CKL_0463 groES -84 7.9 TTAGCACTCATAATTAATGAGTGCTAA
CKL_2212 htpG -202 7.1 TTAGCACTCAAGTATTATAAGTGCTAA
Clostridium novyi NT
NT01CX_0059 hrcA -49 7.5 TTAGCACTCAACTAAAACGAGTGCTAA
NT01CX_0463 groES -82 7.9 TTAGCACTCGATGTTATTGAGTGCTAA
Clostridium perfringens ATCC 13124
CPF_2292 hrcA -43 7.5 TTAGCACTCGTTCAGAGTGAGTGCTAA
CPF_2574 groES -64 7.9 TTAGCACTCTATATTAATGAGTGCTAA
CPF_0417 htpG -63 7.1 TTAGCACTCAAGTTGTTAGAGTGCTAA
Clostridium tetani E88
CTC02033 hrcA -20 7.7 TTAGCACTCAACAAGAGTGAGTGCTAA
CTC01489 htpG -71 6.9 TTAGCACTCAGCAAATTGGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD