Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Clostridia-3

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Clostridia-3
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides pectinophilus ATCC 43243
BACPEC_01132 groES -56 7.2 TTAGCACTCGAGATAAATGAGTGCTAA
BACPEC_00901 htpG -98 7.1 TTAGCACTCTTTTATAATGAGTGCTGA
BACPEC_00937 hrcA -20 7.1 TTAGCACTCCACAACAATGAGTGCTAA
BACPEC_02725 hsp20 -188 7.2 TTAGCACTCACCTCTTGACAGTGCTAA
Blautia hansenii DSM 20583
BLAHAN_03125 htpG -98 7.3 TTAGCACTCAATATGATTGAGTGCTAA
BLAHAN_00278 groES -16 7.3 TTAGCACTCAATTGCAATGAGTGCTAA
BLAHAN_00277 groEL -388 7.3 TTAGCACTCAATTGCAATGAGTGCTAA
BLAHAN_00302 hrcA -51 6.8 TTAGCACTCCACCACAACGAGTGCTAA
Bryantella formatexigens DSM 14469
BRYFOR_02916 htpG -111 7.5 TTAGCACTCACCTAAAATGAGTGCTAA
BRYFOR_04762 groES -41 7.3 TTAGCACTCGACTGAAATGAGTGCTAA
BRYFOR_04763 groEL -359 7.3 TTAGCACTCGACTGAAATGAGTGCTAA
BRYFOR_00981 hrcA -52 7.2 TTAGCACTCGATTCGAAAGAGTGCTAA
BRYFOR_01706 hsp20 -153 7.1 TTAGCACTCCCTCTTGACGAGTGCTAA
BRYFOR_02574 hsp20 -161 7.2 TTAGCACTCACTCTTGACGAGTGCTAA
Clostridiales bacterium 1_7_47_FAA
Cbac1_010100019775 htpG -131 7.5 TTAGCACTCAATAAAAATGAGTGCTAA
Cbac1_010100016738 groES -126 7 TTAGCACTCAAGTCTTGACAGTGCTAA
Cbac1_010100002312 hrcA -51 6.8 TTAGCACTCCTCGAAACCGAGTGCTAA
Cbac1_010100022827 clpB -166 7.1 TTAGCACTCACCCCTTGACAGTGCTAA
Cbac1_010100004682 hsp20 -100 7.2 TTAGCACTCACCTCTTGACAGTGCTAA
Clostridium bolteae ATCC BAA-613
CLOBOL_06802 groES -124 7.2 TTAGCACTCAACTCTTGACAGTGCTAA
CLOBOL_06029 htpG -130 7.5 TTAGCACTCAACAAAAATGAGTGCTAA
CLOBOL_02018 hrcA -16 6.9 TTAGCACTCCCGAACGTTGAGTGCTAA
CLOBOL_03752 hsp20 -167 6.1 TTAGCACTCGACTCTTGACTTTGCTAA
CLOBOL_01718 clpB -149 7 TTAGCACTCGACCCTTGACAGTGCTAA
CLOBOL_03574 hsp20 -75 7.2 TTAGCACTCACCTCTTGACAGTGCTAA
Clostridium nexile DSM 1787
CLONEX_00414 groEL -375 7 TTAGCACTCGGACAAAGTGAGTGCTAA
CLONEX_00415 groES -63 7 TTAGCACTCGGACAAAGTGAGTGCTAA
CLONEX_03837 htpG -92 7.5 TTAGCACTCACTTTAAAAGAGTGCTAA
CLONEX_00290 hrcA -54 7.3 TTAGCACTCGAAAGAATAGAGTGCTAA
CLONEX_03691 hsp20 -136 7.2 TTAGCACTCACCTCTTGACAGTGCTAA
CLONEX_03685 clpB -89 7.1 TTAGCACTCACCCCTTGACAGTGCTAA
Clostridium scindens ATCC 35704
CLOSCI_00050 groEL -397 7.5 TTAGCACTCTCTTTTTATGAGTGCTAA
CLOSCI_00049 groES -58 7.5 TTAGCACTCTCTTTTTATGAGTGCTAA
CLOSCI_01188 hrcA -54 7.3 TTAGCACTCGAAAATGTAGAGTGCTAA
CLOSCI_02851 hsp20 -97 7.2 TTAGCACTCATCTATTGACAGTGCTAA
CLOSCI_02798 clpB -94 7.2 TTAGCACTCACCTCTTGACAGTGCTAA
CLOSCI_04021 hsp20 -100 7.3 TTAGCACTCAATACTTGACAGTGCTAA
Dorea formicigenerans ATCC 27755
DORFOR_02548 htpG -156 7.2 TTAGCACTCGATGAAAAAGAGTGCTAA
DORFOR_00902 groES -16 7 ATAGCACTCTCTTTTTATGAGTGCTAA
DORFOR_00808 hrcA -16 7.3 TTAGCACTCCAATATAATGAGTGCTAA
DORFOR_00449 hsp20 -180 7.2 TTAGCACTCACCTCTTGACAGTGCTAA
DORFOR_02181 clpB -84 6.8 TTAGCACTCACCTCTTGACTGTGCTAA
Dorea longicatena DSM 13814
DORLON_02814 htpG -171 7.4 TTAGCACTCTTTTTAAAAGAGTGCTAA
DORLON_01663 groEL -383 7 TCAGCACTCTCTTTTGTTGAGTGCTAA
DORLON_01664 groES -59 7 TCAGCACTCTCTTTTGTTGAGTGCTAA
DORLON_01874 hrcA -74 7.2 TTAGCACTCAGATAAAAAGAGTGCTAA
DORLON_00596 hsp20 -163 7.4 TTAGCACTCACTATTGACGAGTGCTAA
DORLON_02781 hsp20 -207 7.3 TTAGCACTCACCTATTGACAGTGCTAA
DORLON_02510 hsp20 -184 7.3 TTAGCACTCACCTCTAGACAGTGCTAA
DORLON_02511 clpB -84 6.5 TTAGCACTCGGGGGTTGACAGTGCTAA
Eubacterium eligens ATCC 27750
EUBELI_00519 groES -16 7.2 TTAGCACTCGAAAAGAATGAGTGCTAA
EUBELI_01321 htpG -105 7.3 TTAGCACTCTTATTTAAGGAGTGCTAA
EUBELI_01362 hrcA -16 7.2 TTAGCACTCCAATCTGATGAGTGCTAA
EUBELI_20272 hsp20 -178 7.1 TTAGCACTCACCCCTTGACAGTGCTAA
EUBELI_01260 clpB -115 7.2 TTAGCACTCACCTCTTGACAGTGCTAA
Eubacterium rectale ATCC 33656
EUBREC_1574 null -400 7.5 TTAGCACTCACTATTTTTGAGTGCTAA
EUBREC_2271 groES -20 7.3 TTAGCACTCGAAAGAAATGAGTGCTAA
EUBREC_1909 hrcA -123 6.2 TTAGCACTCGAGGGTTGACATTGCTAA
EUBREC_1909 hrcA -64 7.1 TTAGCACTCCAAAATACAGAGTGCTAA
EUBREC_3394 hsp20 -157 7.4 TTAGCACTCTCTATTGACGAGTGCTAA
EUBREC_3358 hsp20 -157 7.3 TTAGCACTCGCTATTGACGAGTGCTAA
EUBREC_3351 hsp20 -204 7.3 TTAGCACTCGCTATTGACGAGTGCTAA
EUBREC_2855 hsp20 -109 7.3 TTAGCACTCGCTATTGACGAGTGCTAA
EUBREC_2562 clpB -133 7.2 TTAGCACTCTCACTTGACGAGTGCTAA
Roseburia intestinalis L1-82
ROSINTL182_03168 htpG -132 7.1 TTAGCACTCATTAAAAAAGAGTGCTGA
ROSINTL182_02484 groES -78 7.4 TTAGCACTCAAAAGAAATGAGTGCTAA
ROSINTL182_03539 hrcA -58 7.3 TTAGCACTCCACAATAATGAGTGCTAA
ROSINTL182_00166 hsp20 -180 6.8 TTAGCACTCACCTCTTGACAGCGCTAA
ROSINTL182_02758 clpB -157 7.2 TTAGCACTCACCTCTTGACAGTGCTAA
Ruminococcus gnavus ATCC 29149
RUMGNA_00155 htpG -34 7.4 TTAGCACTCAACTGAAAAGAGTGCTAA
RUMGNA_02096 groES -54 7.1 TTAGCACTCGATATGAACGAGTGCTAA
RUMGNA_02097 groEL -395 7.1 TTAGCACTCGATATGAACGAGTGCTAA
RUMGNA_00418 hrcA -20 7.3 TTAGCACTCAAAACAAAGGAGTGCTAA
RUMGNA_00923 hsp20 -150 6.8 TTAGCACTCACCACTTGACAGTGCCAA
RUMGNA_00181 clpB -83 5.6 TTAGCACTCTTCTCTTGACGTGGCTAA
Ruminococcus lactaris ATCC 29176
RUMLAC_00300 htpG -96 7.4 TTAGCACTCTATTTAAAAGAGTGCTAA
RUMLAC_02470 groES -54 7.2 TTAGCACTCAAGTGAAAAGAGTGCTAA
RUMLAC_02471 groEL -372 7.2 TTAGCACTCAAGTGAAAAGAGTGCTAA
RUMLAC_02656 hrcA -68 7.1 TTAGCACTCAAAAGCAGGGAGTGCTAA
RUMLAC_01519 hsp20 -196 6.7 TTGGCACTCAACACTTTACAGTGCTAA
RUMLAC_01141 clpB -95 7.2 TTAGCACTCAACTCTTTACAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD