Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AguR in Lactobacillaceae

Properties
Regulator family: RpiR
Regulation mode:
Biological process: Agmatine utilization
Effector:
Regulog: AguR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus brevis ATCC 367
LVIS_2210 ptcA -157 5.6 GAATGAAACATGTGTCACCA
Lactobacillus sakei subsp. sakei 23K
LSA0067 ptcA -121 4.8 AAATGGAACAAAATACACAT
Pediococcus pentosaceus ATCC 25745
PEPE_0189 ptcA -145 6.2 AAATGAAACATGTTTCATGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD