Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FlpA in Lactobacillaceae

Properties
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Heavy metal resistance
Effector: Oxygen
Regulog: FlpA - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus acidophilus NCFM
LBA0542 copZ -81 6 AAATTGACGATCATCAAGTT
LBA0541 cadA -75 5.4 ATCTTGATAACAGTCAAGTC
Lactobacillus casei ATCC 334
LSEI_0070 cadA -68 4.8 AAGTTGATCACCGTCAAGGC
LSEI_0071 copZ -76 5.4 AACTTGACGACGATCAAGGA
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_0427 cadA -77 5.3 ATCTTGATAGAAATCAATTG
Lactobacillus fermentum IFO 3956
LAF_1702 cadA -69 5.2 CTCTTGATTCCGATCAATTT
LAF_1700 dps -298 5.1 AAGTTGATGAGGATCAATTA
LAF_1701 copZ -68 5.1 AAGTTGATGAGGATCAATTA
LAF_1466 copZ -91 4.8 AAGTTGATAGAAAACAATTT
Lactobacillus johnsonii NCC 533
LJ1696 cadA -75 5.2 ATCTTGATAATAGTCAAGTC
LJ1695 copZ -82 6 AAATTGACGATCATCAAGTT
Lactobacillus plantarum WCFS1
lp_1442 flpA -31 5.3 AAATTGACATAAATCAAGAA
lp_3435 cadA -78 6.1 AACTTGACGCCTATCAAGTT
lp_3442 copZ -75 6 TTCTTGACGGCCGTCAAGTT
lp_3444 flpA -142 6 AACTTGACGGCCGTCAAGAA
Lactobacillus reuteri JCM 1112
LAR_1340 copZ -69 5.7 AAATTGATGATAATCAATTT
LAR_1339 dps -298 5.7 AAATTGATGATAATCAATTT
Lactobacillus rhamnosus GG
LGG_00083 copZ -76 6 AACTTGACGGCCATCAAGGT
LGG_00082 cadA -68 5.3 AAATTGATCCCGGTCAAGGT
Lactobacillus sakei subsp. sakei 23K
LSA1783 copZ -79 6.1 AACTTGATGGCGATCAATTT
LSA1784 cadA -75 6.3 AACTTGATGGCTATCAAGTT
Lactobacillus salivarius subsp. salivarius UCC118
LSL_1786 cadA -210 5.6 AACTTGATAGCCATAAATTT
LSL_1782 flpA -89 5.6 TTCTTGATGTGCATCAATTT
LSL_1781 dps -118 5.5 TTCTTGATGAGCGTCAATTT
LSL_1784 copZ -129 5.9 AACTTGATATGCGTCAATTT
LSL_1786 cadA -88 5.7 AACTTGATGTCAGTCAATTA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_A04 copZ -66 5.2 TAATTGATCTATATCAAGTA
LEUM_A03 cadA -76 6.3 AACTTGATGGACGTCAAGTT
Oenococcus oeni PSU-1
OEOE_0354 copZ -126 6 TTCTTGACGGCCGTCAAGTT
OEOE_0355 flpA -142 6 AACTTGACGGCCGTCAAGAA
Pediococcus pentosaceus ATCC 25745
PEPE_0409 copZ -75 5.7 AAATTGACCTACGTCAATTT
PEPE_0408 flpA -74 5.7 AAATTGACGTAGGTCAATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD