Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FlpA in Streptococcaceae

Properties
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Heavy metal resistance
Effector: Oxygen
Regulog: FlpA - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_1043 copZ -76 6 TAATTGATACAAATCAATTT
LACR_1042 cadA -75 5.8 TTATTGACAGAAATCAATTT
Lactococcus lactis subsp. lactis Il1403
L134080 copZ -88 5.7 TTCTTGATGTAAATCAATGT
L63697 cadA -74 5.8 TTCTTGATGGCTATCAATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD