Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CzcR2 in Lactobacillaceae

Properties
Regulator family: ArsR
Regulation mode:
Biological process: Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Regulog: CzcR2 - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus brevis ATCC 367
LVIS_0396 cadD2 14 6.1 ATATGTTGAAAATAACATAT
LVIS_0396 cadD2 -2 5.9 ATATGAATATGATAACATAT
LVIS_0395 czcR2 -40 5.9 ATATGTTATCATATTCATAT
LVIS_0395 czcR2 -56 6.1 ATATGTTATTTTCAACATAT
Lactobacillus rhamnosus GG
LGG_02417 czcX -68 6 TTATGTTGACATTAACATAT
Pediococcus pentosaceus ATCC 25745
PEPE_0029 cadD2 -51 6.1 ATATGAATATGTTATCATAT
PEPE_0028 czcR2 -34 6.1 ATATGATAACATATTCATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD