Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CzcR1 in Lactobacillaceae

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Regulog: CzcR1 - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_1220 czcD -76 6.4 ATATACCAAAAATGATATAT
LBUL_1221 czcR1 -88 6.4 ATATATCATTTTTGGTATAT
LBUL_1220 czcD -113 5 GTATATTATTTTTGTAATAT
LBUL_1221 czcR1 -51 5 ATATTACAAAAATAATATAC
Lactobacillus johnsonii NCC 533
LJ0377 czcD -35 6.3 GTATACCAAATTCGATATAT
LJ0377 czcD -72 6.1 ATATATCAAAAATGGAATAT
LJ0376 czcR1 -40 6.1 ATATTCCATTTTTGATATAT
LJ0376 czcR1 -77 6.3 ATATATCGAATTTGGTATAC
Lactobacillus reuteri JCM 1112
LAR_1705 cadD1 -60 6.5 ATATATCAAATTCGATATAT
LAR_1705 cadD1 -33 6.3 GTATATCGAATTTGATATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD