Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BusR in Lactobacillaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Betaine utilization
Effector: Betaine
Regulog: BusR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_0357 busA -146 7.7 AGAGACAACTTGTTATAAAGTATAGGTTGTCACT
LEUM_0356 busR -103 7.7 AGTGACAACCTATACTTTATAACAAGTTGTCTCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD