Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BusR in Streptococcaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Betaine utilization
Effector: Betaine
Regulog: BusR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_1542 busA -155 7.9 AGTGACTACATATTGTTATTATTGAGTGGTCACT
Lactococcus lactis subsp. lactis Il1403
L74195 busA -155 7.9 AGTGACTACATATTGTTATTATTGAGTGGTCACT
Streptococcus sanguinis SK36
SSA_0386 busA -55 7.7 AGTGACAACTCATTAAAATAAAAATGTAGTCACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD