Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SusR2 in Bacteroidaceae

Properties
Regulator family: [Other]
Regulation mode: repressor
Biological process: Starch utilization
Effector:
Regulog: SusR2 - Bacteroidaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides cellulosilyticus DSM 14838
BACCELL_04952 susC2 -208 5.7 ATTTTTACTACTTTTTTGGA
BACCELL_04952 susC2 -131 6.2 AAAACTACTACTTTTTCACT
Bacteroides ovatus ATCC 8483
BACOVA_02787 susC2 -204 6.6 AAAATCACTACTTTTTTAGT
BACOVA_02787 susC2 -127 5.9 TAAATCACTATATTTTTGCT
Bacteroides stercoris ATCC 43183
BACSTE_01926 susC2 -273 6.3 TAAATCACTACTTTTTCACT
BACSTE_01926 susC2 -350 6.1 ATTTTTACTACTTTTTTAGT
Bacteroides thetaiotaomicron VPI-5482
BT3090 susC2 -186 6.1 AAATCCACTACTTTTTTAGC
BT3090 susC2 -109 5.9 TAAACCACTATATTTTTGCT
Bacteroides uniformis ATCC 8492
BACUNI_01942 susC2 -206 6.2 ATTTTCACTACTTTTTTAGT
BACUNI_01942 susC2 -129 6.5 TAAACCACTACTTTTTTACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD