Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AgaR in Streptococcaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: N-acetylgalactosamine utilization
Effector: N-acetylgalactosamine
Regulog: AgaR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0679 bgaC -89 5.3 TTAGCTATTATAACAAAAAA
SDEG_0678 agaR -51 5.3 TTTTTTGTTATAATAGCTAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0741 bgaC -116 4.7 AATACGATTATAGCAAAAAT
Sez_0740 agaR -43 4.7 ATTTTTGCTATAATCGTATT
Streptococcus gordonii str. Challis substr. CH1
SGO_0043 bgaC -67 5.6 AATGTTATTATATTAATTAA
SGO_0042 agaR -107 5.6 TTAATTAATATAATAACATT
Streptococcus mitis B6
smi_0079 bgaC -56 5.5 ATATTTAATATATCAACAAA
smi_0078 agaR -282 5.5 TTTGTTGATATATTAAATAT
Streptococcus pneumoniae TIGR4
SP_0060 bgaC -56 5.6 ATAATTAATATAACAACAAA
SP_0058 agaR -312 5.6 TTTGTTGTTATATTAATTAT
Streptococcus sanguinis SK36
SSA_0053 bgaC -61 5.5 AAATTTATTATATTAATATT
SSA_0052 agaR -98 5.5 AATATTAATATAATAAATTT
Streptococcus suis 05ZYH33
SSU05_0449 bgaC -48 4.9 AGTGTTAGTATATTAATAGA
SSU05_0448 agaR -157 4.9 TCTATTAATATACTAACACT
Streptococcus uberis 0140J
SUB0042 bgaC -103 5.1 AGAACTATTATAACAGAAAT
SUB0041 agaR -53 5.1 ATTTCTGTTATAATAGTTCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD