Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PerR in Bacteroidaceae

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Peroxide stress response; Oxidative stress response
Effector: Hydrogen peroxide
Regulog: PerR - Bacteroidaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides cellulosilyticus DSM 14838
BACCELL_05678 perR -36 6.6 AAAAATGTAATTATTACAAGTTT
BACCELL_00993 acn -47 6.1 TAATTTGTAATCTTTACAATATT
BACCELL_00354 ftn -40 5.8 ACTTTTGTAATGATTTCAAATTA
BACCELL_04244 BT1211 -29 6.5 ATATTTGTAATGATTATAAATTT
Bacteroides dorei DSM 17855
BACDOR_01950 rbr2 -93 6.7 ATAATTGTAATGAATACAATTTT
BACDOR_03683 perR -30 6.1 AAAATTGTAATAGTTACAAAAAG
BACDOR_03102 acn -25 5.9 AAAACTGTAATAATTATAAATTG
BACDOR_00877 tpx -44 5.7 AAATTTGTTATCATTACAGTATC
BACDOR_04898 ahpC -55 6 GCAAATGTAATAATTACAATTTA
BACDOR_04357 ftn -41 5.7 ATATTTGCAACAGTTACAATTTA
BACDOR_04415 BT1211 -34 5.9 TTCTTTGTAATTATTACAACTTT
Bacteroides eggerthii DSM 20697
BACEGG_01512 perR -37 6.6 AAAAATGTAATTATTACAAGTTT
BACEGG_00294 acn -48 6.1 TAATTTGTAATCTTTACAATATT
BACEGG_01676 ftn -39 6.3 ATATTTGTAATCATTTCAATTTA
BACEGG_02389 BT1211 -30 6.2 ATATTTGTAATGATTATAATTTG
Bacteroides fragilis NCTC 9343
BF3019 perR -39 6.8 AAAATTGTAATGAATACAATTTT
BF2364 PF05140 -86 6.2 AAAATTGTATTTAATACAAATTA
BF3647 PF01637 -36 5.9 ATATTTGCAATAATTATAAATAT
Bacteroides ovatus ATCC 8483
BACOVA_00376 perR -40 6.3 ATAATTGTAATGAATACAACTTT
BACOVA_02789 PF01637 -33 5.6 ATATTTGTAATAATTGTATTTAT
BACOVA_03967 BT1211 -35 6.2 ATATTTGTACTCATTACAAATTA
Bacteroides plebeius DSM 17135
BACPLE_02660 perR -33 5.9 AGAATTGTAACAATTACATAATT
BACPLE_00297 rbr2 -94 6.7 AAAATTGTAATGATTTCAAATTT
BACPLE_02893 PF05140 -79 5.9 AGATTTGTTATCTTTACAATTTT
BACPLE_03494 PF00576 -50 6.1 ATATTTGTAATTGTTACAATCTT
BACPLE_02813 BT1211 -28 5.5 TACTTTGTAATCATTATAAAAAT
Bacteroides stercoris ATCC 43183
BACSTE_01825 perR -37 6.6 AAAAATGTAATTATTACAAGTTT
BACSTE_03162 acn -45 6.1 TAATTTGTAATATTTACAATATT
BACSTE_00720 ftn -39 6.3 ATATTTGTAATCATTTCAATTTA
BACSTE_00833 BT1211 -29 6.2 ATATTTGTAATGATTATAATTTG
Bacteroides thetaiotaomicron VPI-5482
BT0215 perR -40 6.3 ATAATTGTAATGAATACAACTTT
BT1604 PF05140 -94 6.1 CTACTTGTAACGATTACAATTTT
BT1211 BT1211 -35 6.2 ATATTTGTACTCATTACAAATTC
Bacteroides uniformis ATCC 8492
BACUNI_01378 perR -38 6.6 AAAAATGTAATAATTACAAGTTT
BACUNI_01674 acn -45 6 TAATTTGTAATCTTTACAATAAT
BACUNI_04391 ftn -36 5.8 ACTTTTGTAATGATTTCAATTTA
BACUNI_04341 tpx -35 5 TAATTTGTTATGTATACATATAA
BACUNI_02171 BT1211 70 6.5 ATATTTGTAATCATTATAATTTT
Bacteroides vulgatus ATCC 8482
BVU_1137 rbr2 -92 6.4 GTAATTGTAATAAATACAATTTT
BVU_2366 perR -30 6.1 AAAATTGTAATAGTTACAAAAAG
BVU_1959 acn -19 5.6 AAAACTGTAATAATTATAAATGG
BVU_3944 tpx -44 5.7 AAATTTGTTATCATTACAGTATC
BVU_0847 ahpC -55 6 GCAAATGTAATAATTACAATTTA
BVU_2754 ftn -40 5.7 ATATTTGCAACAGTTACAATTTA
BVU_2799 cydA -276 5.9 TTCTTTGTAATTATTACAACTTT
Bacteroides coprophilus DSM 18228
BACCOPRO_01403 perR -33 6.1 AAAATTGTAATAGTTACAGAATT
BACCOPRO_00127 rbr2 -93 6.8 AAAGTTGTAATGATTACAATTTT
BACCOPRO_00708 PF05140 -79 6 ACAATTGTTATCTTTACAATTTT
BACCOPRO_01040 tpx -56 6.3 ATATTTGTAATTATTACATATCT
BACCOPRO_03297 ahpC -55 6.1 TGCATTGTAATAATTACAAATTT
BACCOPRO_00522 BT1211 -28 5.2 TCCTTTGTAATTATTATAAAAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD