Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NanR in Bacteroidaceae

Properties
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Regulog: NanR - Bacteroidaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides cellulosilyticus DSM 14838
BACCELL_01010 exbB -44 5.7 ATAATAAACAAATTAATTAATTA
BACCELL_04950 nanR -37 5.5 ATATTAATAAAATTATTAAGTAT
Bacteroides coprophilus DSM 18228
BACCOPRO_02433 exbB -43 5 TTTATAAACTATTAATTAATTAA
BACCOPRO_02518 nanA -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides dorei DSM 17855
BACDOR_01206 susC_Nan-5 -163 4.8 GTTATAATAAAATATTTTTGTTT
BACDOR_01206 susC_Nan-5 -160 5 ATAATAAAATATTTTTGTTTATA
BACDOR_00694 nanA -111 5.5 TTATTAATAAATAAATTTAGTTT
BACDOR_00694 nanA -40 4.8 TAAGTAATATAAAATATTCATTT
BACDOR_00663 nanH -47 4.8 ATTTCAATAAAAACTTTTATTTT
BACDOR_00695 nanR -217 5.5 AAACTAAATTTATTTATTAATAA
Bacteroides eggerthii DSM 20697
BACEGG_00309 exbB -44 5.5 ATAATAAGTAATTTAATTAATTA
BACEGG_02292 PF04074 -94 6.2 ATAATAAAATAATTTATTAATTA
BACEGG_02293 nanT-II -85 6 TTAATAAAATAATTTATTAAATA
BACEGG_02291 nanR -58 6.2 TAATTAATAAATTATTTTATTAT
Bacteroides fragilis NCTC 9343
BF1719 susC_Nan-5 -39 5.3 ATTATAATTTTCTTTATTATTAA
BF1796 fucA -21 5.3 TATTTAATATAATTATATAATAT
BF3530 exbB -43 5.5 ATAATAATAATTTAATTAATTAA
BF1712 nanA -150 6.3 TTATTAATAAAATATTTTATTAT
BF1712 nanA -41 5.3 ATATTAAAAATCTATATCATTAA
BF2953 nagB-II -128 4.8 TAGGTAAAAAAAGATTTTAATTT
BF1806 nanH -91 5.6 TATATAATAAAATATTTAATTAA
BF1806 nanH -88 6.1 ATAATAAAATATTTAATTAATAT
BF1814 manA -27 5.1 ATATTAATAAATAATAGTATTGA
BF1711 nanR -52 4.8 TTAATAAACAAATTAACTATCTT
Bacteroides ovatus ATCC 8483
BACOVA_01792 BT0434 -100 5.9 TTAATAAAATATTTTATTATCTA
BACOVA_01792 BT0434 -103 6.3 TTATTAATAAAATATTTTATTAT
BACOVA_00648 exbB -39 4.8 ATAATAATCAATTAATTAATCTT
BACOVA_00275 nanA -194 4.9 AAAATAACTAAATATATTAAACT
BACOVA_01791 nanR -50 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides plebeius DSM 17135
BACPLE_00590 susC_Nan-5 -267 5.2 TATATAAATAATATTTTTATCAT
BACPLE_00590 susC_Nan-5 -156 5 TTCATAAAATATTTTATCAAATA
BACPLE_01828 nagB -122 4.9 TAAAAAATCTATTTTTTTATTTG
BACPLE_00596 nanM -234 5.4 TCATTAATAAATTATTATATTTA
BACPLE_00597 nanR -88 5.4 TAAATATAATAATTTATTAATGA
BACPLE_02962 nahC -81 5 ATAATAAATTTATATATTTACAT
Bacteroides stercoris ATCC 43183
BACSTE_02458 susC_Nan-6 -25 5.3 TAAATAACCAATTAAATTAATAT
BACSTE_03148 exbB -44 5.5 ATAATAAGTAATTTAATTAATTA
BACSTE_01903 PF04074 -92 6 ATAATAAAATAATTTATTATATA
BACSTE_01904 nanT-II -94 5.8 TATTTAATAAAATAAATTATTAA
BACSTE_01902 nanR -242 6 TATATAATAAATTATTTTATTAT
Bacteroides thetaiotaomicron VPI-5482
BT0434 BT0434 -98 6.3 TTATTAATAAAATATTTTATTAT
BT0434 BT0434 -95 5.9 TTAATAAAATATTTTATTATCTA
BT2055 exbB -39 4.8 ATAATAATCAATTAATTAATCTT
BT0433 nanR -51 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides uniformis ATCC 8492
BACUNI_01022 susC_Nan-6 -25 5.6 TTAATAACTAATTAAATTAATAT
BACUNI_01022 susC_Nan-6 -21 4.8 TAACTAATTAAATTAATATTTAT
BACUNI_01658 exbB -44 5.9 ATAATAAATAAATTAATTAATTA
BACUNI_01404 nagB-II -18 5.3 TTATTAATAATAAATTTTATGAA
BACUNI_01205 bgaA -26 5 ATATTAACAAAATCTTTTAAAGA
BACUNI_02075 nanR -52 5.1 AATTTACAAAATTATTTTAGTAT
Bacteroides vulgatus ATCC 8482
BVU_2433 fucA -92 6.1 TTTTTAATAAATTATTTTATTAA
BVU_2029 susC_Nan-1 -38 5 AAGTTCATTTAATTTTTTAATTA
BVU_2029 susC_Nan-1 -18 5.1 TTAATAAATTACTAATTTATGAA
BVU_2031 GH43 -5 5 TAATTATGAAAGTATTTTATTAT
BVU_4117 nanA -111 5.5 TTATTAATAAATAAATTTAGTTT
BVU_4117 nanA -108 5.2 TTAATAAATAAATTTAGTTTTTA
BVU_4117 nanA -40 4.8 TAAGTAATATAAAATATTCATTT
BVU_4143 nanH -47 4.8 ATTTCAATAAAAACTTTTATTTT
BVU_4116 nanR -190 5.5 AAACTAAATTTATTTATTAATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD