Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CtsR in Lactobacillaceae

Properties
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus brevis ATCC 367
LVIS_0654 clpP -90 6.2 TTTTGTTTGACCTACTCTGACCTT
LVIS_1554 clpE -84 0.6 ATGGTCAAGAAAGGTCAAGCCTTT
LVIS_0762 clpB -139 -1.6 TTGGTCAAAAAAGGTCAAATTATT
LVIS_1701 ctsR -45 -1.1 TTAGTCAGCATTAGTCAAATAAGT
Lactobacillus casei ATCC 334
LSEI_0963 clpP -85 7 AAATCTTTGACCTTATTTGACTTT
LSEI_1762 clpE -198 0.1 TAGGTCAAGAAAGGTCAAACCTTT
LSEI_2518 ctsR -39 -0 ATAGTCAAGATTGGTCAAAGTCAA
Lactobacillus fermentum IFO 3956
LAF_0360 clpP -90 6.6 AATGATTTGACCTTTTTTGACCTA
LAF_0749 hrcA -89 6.4 AGATCTTTGACTTTTGTTGACTTT
LAF_1388 clpE -48 -0.7 ATGGTCAAGAAAAGTCAAAGGTTG
LAF_0325 groS -153 -0.6 TTGGTCAAAATTAGTCAAAGTTTT
Lactobacillus plantarum WCFS1
lp_0786 clpP -92 5.8 TTTCTTTTGACCTTCACTGACCTT
lp_2029 hrcA -91 5.9 AATACTTTGTCTTTCCTTGACTTT
lp_1903 clpB -118 6.5 AAATCCTTGACCTTGTTTGACCTT
lp_1269 clpE -93 -2.3 AAGGTCAACAAAGGTCAAAGAGCC
lp_1018 ctsR -41 -0.3 ATAGTCAATATTAGTCAAAGATAA
Lactobacillus reuteri JCM 1112
LAR_0379 clpP -93 6.7 AAACATTTGACCTTTTTTGACCAA
LAR_0677 hrcA -101 6.5 AATTGTTTGACGTTTCTTGACTTT
LAR_1257 clpE -59 0.2 ATGGTCAAGAAAGGTCAAAACATT
LAR_0342 groS -128 -1.1 ATGGTCAAAAAAAGTCAAAGTGTT
Lactobacillus rhamnosus GG
LGG_00931 clpP -88 7 AAATCTTTGACCTTATTTGACTTT
LGG_01367 clpB -73 6.2 AATAGTTTGACCTTAACTGACCAA
LGG_01823 clpE -69 0.1 TAGGTCAAGAAAGGTCAAACCTTT
LGG_02500 ctsR -39 -0 ATAGTCAAGATTGGTCAAAGTCAA
Lactobacillus sakei subsp. sakei 23K
LSA0531 clpP -116 6 TACCATTTGACCATAGTTGACCTT
LSA1238 hrcA -87 5.3 CAATTCTTGACTTTATTTGACGTT
LSA1040 clpB -89 6.5 GAATGTTTGACCTATTTTGACTAT
LSA1465 clpE -66 -1.8 AAGGTCAAAGATAGTCAAACAAAC
LSA1780 ctsR -77 -0.8 ATAGTCAACGTTAGTCAAAGTTAA
Lactobacillus salivarius subsp. salivarius UCC118
LSL_1168 clpP -101 6.3 TTAAATTTGACCATTATTGACCTT
LSL_0386 clpE -57 -1.6 AAGGTCAAAGTTGGTCAAAATAAC
LSL_0863 clpB -75 -1 AAGGTCAAACTTAGTCAAAGTTTA
LSL_0195 ctsR -42 -1 AAAGTCAATGTAGGTCAAACCTAC
Oenococcus oeni PSU-1
OEOE_1310 grpE -71 6.5 AAATGTTTGACCAATCTTGACTAT
OEOE_1397 groS -72 6.7 AAAAGTTTGACCTTTTTTGACCAA
OEOE_0570 clpP -63 6.7 AAAAGTTTGACCTTTCTTGACCAT
OEOE_0289 hsp -96 6.5 TTTTATTTGACCTTTCTTGACTTT
OEOE_0640 clpE -27 -1.3 AAGGTCAATAAAGGTCAAACATTG
OEOE_0513 ctsR -21 -0.9 TTAGTCAGGAATGGTCAAATTATG
Pediococcus pentosaceus ATCC 25745
PEPE_0455 clpP -95 6.9 AAATATTTGACCTTTTTTGACCAA
PEPE_0894 hrcA -107 6 AGATGTCTGACCAAATTTGACTAT
PEPE_0607 clpE -223 -1.5 ATGGTCAATATTGGTCAAACATCA
PEPE_0420 groS -128 -0.9 TTGGTTAATAAAGGTCAAAAATAC
PEPE_1428 ctsR -38 -0.6 ATAGTCAACATTAGTCAGAGTATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD