Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CtsR in Streptococcaceae

Properties
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_1612 clpB -98 6.3 AAAAGCTTGACCATTACTGACTAA
LACR_0700 clpP -110 6.8 TTTTCTTTGACCTTTTTTGACCAA
LACR_0439 groS -95 5.9 TTTCTCTTGACTAAATCTGACCAT
LACR_0665 ctsR -56 0.4 ATAGTCAGTAATAGTCAAAGATTA
LACR_0577 yffA -119 -0.4 ATGGTCAAATATGGTCAAGCTTTT
Lactococcus lactis subsp. lactis Il1403
L72391 clpP -110 6.8 TATTCTTTGACCTTTTTTGACCAA
L166407 clpB -98 6.5 AAAAGTTTGACCATTACTGACCAA
L198515 groS -96 5.9 TTTCTCTTGACTAAATCTGACCAT
L0223 ctsR -56 0.4 ATAGTCAGTAATAGTCAAAGATTA
L150017 yffA -117 -0.9 ATGGTCAAATATGGTCAAACTTTT
Streptococcus agalactiae 2603V/R
SAG0488 clpE -65 6.3 TAAAGTTTGACTATATTTGACTAT
SAG1585 clpP -67 6.6 TATTATTTGACCTTTGTTGACCAA
SAG1303 clpL -144 6.3 TATTTATTGACCTTTACTGACTAA
SAG2075 groS -109 6.3 TTTCTCTTGACTAATTCTGACCAA
SAG1829 ctsR -36 -0.7 ATAGTCAGTTATAGTCAAAGAGGA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0851 clpL -180 6.4 TTTTGTTTGACCTTAACTGACCAA
SDEG_2041 groS -106 6.9 TTTTTCTTGACTATTTTTGACCAA
SDEG_1496 clpE -62 6.7 TAAAGTTTGACCATTTTTGACTAA
SDEG_0439 clpP -125 6.5 TATCATTTGACCTTTCTTGACCAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1072 clpL -181 6.3 TTTTGTTTGACCTTTACTGACCTT
Sez_1614 clpP -93 6.8 TATCATTTGACCTTTTTTGACCAA
Sez_0145 groS -110 6.9 TTTTTCTTGACTATTTTTGACCAA
Sez_0605 clpE -63 6.7 TAAAGTTTGACCATTTTTGACTAA
Sez_0139 ctsR -69 0.8 TTAGTCAGTTTTAGTCAAAAATAA
Streptococcus gallolyticus UCN34
GALLO_1249 clpL -190 6.6 AAATATTTGACTTTTACTGACCAA
GALLO_0612 clpE -65 5.7 TGAAGTTTGACTATCTTTGACCTT
GALLO_0124 groS -134 6.8 TTTTTCTTGACTATTTCTGACCAA
GALLO_1763 clpP -127 7 TTTTATTTGACCTTTTTTGACCAA
GALLO_2164 ctsR -66 -0.3 ATAGTCAGTTATAGTCAAAGATAG
Streptococcus gordonii str. Challis substr. CH1
SGO_0688 clpE -65 6.9 TAAAGTTTGACTATTTTTGACCAA
SGO_1886 groS -96 6.9 TTTTTCTTGACTATTTTTGACCAA
SGO_1632 clpP -103 6.6 AAAAATTTGACCTTTATTGACCAA
SGO_1999 ctsR -110 0.5 TTAGTCAAAGATAGTCAATGTCAA
Streptococcus mitis B6
smi_1765 clpL -276 6.3 AAATCCTTGACCTTTTCTGACTAA
smi_0865 clpE -62 6.3 TAGAATTTGACTATTTTTGACCTT
smi_0481 groS -102 6.8 TTTTTCTTGACTATTTCTGACCAA
smi_1417 clpP -89 6.8 AAAAATTTGACCTTTTTTGACCAA
smi_2046 ctsR -44 0.4 ATAGTCAAAGATAGTCAAGGTTTA
Streptococcus mutans UA159
SMU.1955 groS -91 6.9 TTTTTCTTGACTATTTTTGACCAA
SMU.562 clpE -74 6.6 TAAAGTTTGACCATTATTGACCAT
SMU.1672 clpP -68 6.8 AAATATTTGACCTTTTTTGACCAA
Streptococcus pneumoniae TIGR4
SP_0338 clpL -275 6.5 AAACTCTTGACCTTTTCTGACCAA
SP_0820 clpE -62 6.3 TAGAATTTGACTATTTTTGACCTT
SP_1907 groS -102 6.2 TTTTTCTTGATTATTTCTGACCAA
SP_0746 clpP -89 6.8 AAAAATTTGACCTTTTTTGACCAA
SP_2195 ctsR -44 -0.4 ATAGTCAAACAAGGTCAAGGTTTA
Streptococcus pyogenes M1 GAS
SPy0888 clpL -172 6.3 TTTTGTTTGACCTTTACTGACCTT
SPy1509 clpE -62 6.7 TAAAGTTTGACCATTTTTGACTAA
SPy0395 clpP -125 6.6 TATGATTTGACCTTTATTGACCAA
SPy2072 groS -107 6.9 TTTTTCTTGACTATTTTTGACCAA
SPy2074 ctsR -78 0.1 ATAGTCAGTTTTAGTCAAAATGTA
Streptococcus sanguinis SK36
SSA_0225 groS -97 6.8 TTTTTCTTGACTATTTCTGACCAA
SSA_0669 clpE -73 6.2 AAAACTTTGACTATTTTTGACCTT
SSA_2200 ctsR -77 -0.2 TTAGTCAAAGATAGTCAATGTTAG
SSA_1731 clpP -103 6.6 TTCTATTTGACCTTTTTTGACCAA
Streptococcus suis 05ZYH33
SSU05_0389 clpL -254 6.1 AAACTATTGACTTTTACTGACCAA
SSU05_0147 groS -66 6.5 ATGTTCTTGACTATTTTTGACCAA
SSU05_1551 clpP -67 6.1 TTTTTATTGACCAATTTTGACTAT
SSU05_1976 ctsR -34 -0.9 ATGGTCAAAGATAGTCAAAGAAAG
Streptococcus thermophilus CNRZ1066
str0356 clpP -67 6.2 TTTTATTTGACCTAATTTGACTAA
str0602 clpE -75 6.5 ATAGATTTGACCTTTTTTGACCAA
str0203 groS -124 6.7 TTTTTCTTGACTATTTTTGACTAA
str0076 ctsR -38 -0.7 ATAGTCAGTTATAGTCAAATTAGA
str1614 clpL -84 -0.1 TTGGTCAGTAAAAGTCAATTTTTA
Streptococcus uberis 0140J
SUB0429 clpP -98 6.7 TATTATTTGACCTTATTTGACCAA
SUB0776 clpL -152 6.9 TTTTTCTTGACCTTTTTTGACCAA
SUB1742 groS -108 6.6 TTTTTCTTGACTAATTTTGACCAA
SUB1281 clpE -61 6.7 TAAAGTTTGACCATTTTTGACTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD