Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR in Lactobacillaceae

Properties
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-6-phosphate
Regulog: FruR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus acidophilus NCFM
LBA1779 fruR -52 4.5 TGGTTGATTTTGATGGAGAA
LBA1779 fruR -62 4.5 TGAAGAAAAATGGTTGATTT
Lactobacillus casei ATCC 334
LSEI_1349 fruR -82 5.1 TGACAGTTGTTGAATGTTTT
LSEI_1349 fruR -72 5.9 TGAATGTTTTTGCACGTTTT
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_1889 fruR -189 4.6 TGACGGAAAATGATTGCTTT
Lactobacillus helveticus DPC 4571
lhv_1846 fruR -13 5.8 TGAATAAATATGATTGATTT
lhv_1846 fruR -3 5.2 TGATTGATTTTGAAAGAGAA
Lactobacillus johnsonii NCC 533
LJ0570 fruR -95 5.3 TGACTAATATTGAATGAATA
LJ0570 fruR -85 6.2 TGAATGAATATGAATGATTT
Lactobacillus plantarum WCFS1
lp_2095 fruR -82 5.2 TGGATTATTTTGACGGTTTT
lp_2095 fruR -72 5.7 TGACGGTTTTTGAAGGTTTT
Lactobacillus rhamnosus GG
LGG_01361 fruR -72 5.6 TGAATGTTTTTAACGGTTTT
Lactobacillus sakei subsp. sakei 23K
LSA1048 fruR -83 6.1 TGATTGTTTTTGAACGTTTT
LSA1048 fruR -73 5.4 TGAACGTTTTTGAAATATTT
Lactobacillus salivarius subsp. salivarius UCC118
LSL_0163 fruR -71 5 TGATTTTTTTTGACTATTTA
LSL_0163 fruR -61 5.7 TGACTATTTATGATTGAATT
Pediococcus pentosaceus ATCC 25745
PEPE_1166 fruR -73 5.9 TGAATTTTTTTGAATTAATT
PEPE_1166 fruR -63 6.1 TGAATTAATTTGATTGATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD