Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR in Streptococcaceae

Properties
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-6-phosphate
Regulog: FruR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_1031 fruR -82 5.4 TGAAAGAAAATGATAGTTAA
LACR_1031 fruR -62 5.3 TGATTGATTTTGATAGGTAA
LACR_1031 fruR -72 5.8 TGATAGTTAATGATTGATTT
Lactococcus lactis subsp. lactis Il1403
L0031 fruR -72 5.8 TGATAGTTAATGATTGATTT
L0031 fruR -62 5.5 TGATTGATTTTGAAAGATAA
L0031 fruR -82 5.2 TGGAAGAAAATGATAGTTAA
Streptococcus agalactiae 2603V/R
SAG1348 fruR -85 5 TGATAGTTTTTGGAAGAAAA
SAG1348 fruR -75 5.8 TGGAAGAAAATGCTTGACAT
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0811 fruR -106 5.7 TGGAAGATTATGCTTGACTT
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1106 fruR -107 5.8 TGAAAGATAGTGCTTGACTT
Sez_1106 fruR -117 4.9 TGAATGTTTTTGAAAGATAG
Streptococcus gallolyticus UCN34
GALLO_1319 fruR -76 6.1 TGATAGAAAATGCTTGACAA
GALLO_1319 fruR -86 6 TGATAGAATTTGATAGAAAA
GALLO_1319 fruR -96 4.8 TGAAAAAACTTGATAGAATT
Streptococcus gordonii str. Challis substr. CH1
SGO_1111 fruR -73 6 TGAAAGAAAATGCTTGACTT
SGO_1111 fruR -83 5.9 TGATAGAAAATGAAAGAAAA
Streptococcus mitis B6
smi_1359 fruR -73 5.5 TGATAAAAAATGCTTGACTT
smi_1359 fruR -83 5.4 TGAAAGAAAATGATAAAAAA
smi_1359 fruR -93 5.8 TGATAGATTTTGAAAGAAAA
Streptococcus mutans UA159
SMU.870 fruR -25 5.6 TGGTAGAAATTGCTTGACAG
SMU.870 fruR -35 5.3 TGGTAGAATTTGGTAGAAAT
Streptococcus pneumoniae TIGR4
SP_0875 fruR -73 5.5 TGATAAAAAATGCTTGACTT
SP_0875 fruR -93 5.8 TGATAGATTTTGAAAGAAAA
SP_0875 fruR -83 5.4 TGAAAGAAAATGATAAAAAA
Streptococcus pyogenes M1 GAS
SPy0853 fruR -103 6 TGAAAGATTATGCTTGACTT
SPy0853 fruR -113 5.8 TGATAGATTTTGAAAGATTA
SPy0853 fruR -123 5.8 TGGTAGAATTTGATAGATTT
Streptococcus sanguinis SK36
SSA_1080 fruR -74 5.9 TGATAGAAAGTGCTTGACAT
SSA_1080 fruR -84 5.1 TGGAAGTTTTTGATAGAAAG
Streptococcus suis 05ZYH33
SSU05_0822 fruR -42 5.9 TGAAAGAAAATGATAGAAAA
SSU05_0822 fruR -32 6.2 TGATAGAAAATGATTGACAA
Streptococcus thermophilus CNRZ1066
str0399 fruR -92 4.2 TGAAATATTTTGATTTTTTT
Streptococcus uberis 0140J
SUB0748 fruR -105 5.9 TGATAGATTGTGCTTGACTT
SUB0748 fruR -115 5.7 TGAAAGAAAATGATAGATTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD