Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Crp in Bacteroidaceae

Properties
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Regulog: Crp - Bacteroidaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides cellulosilyticus DSM 14838
BACCELL_02471 PF01694 -196 5 TAATATGTTACACAAAAGATAT
BACCELL_04825 serB -163 5.5 TTTCATGTTATATAACATGTTT
BACCELL_02471 PF01694 -62 5.8 TTTTCTGTTATAGAACAGAATT
BACCELL_00794 null -135 6.1 TTTTATGTTATAAAACATATTT
BACCELL_03929 pflB -107 6 TTTTATGTCGTACAACATAAAA
BACCELL_04404 PF09719 -142 5.6 TTTTATGACATATAACATAAAA
BACCELL_04404 PF09719 -110 5.8 TAATGTGTTATATAACATAAAT
BACCELL_04988 fucR -124 5.2 TTATATGCTGCAAAACATATCC
BACCELL_04758 xylR -83 4.9 AATAGTGCTTTATAACATAATA
BACCELL_03135 susC_Rgu-1 -184 5.8 TTTTCTGTTATATAACATCATT
BACCELL_03480 susC_Crp-3 -225 5.4 TTCTATGTTCTATAACATGCAA
BACCELL_03476 crp -33 4.7 ATTTGTGCTGTATAACACAGTT
BACCELL_05604 araM -105 6 TTTTATGTTACATAACATATAC
Bacteroides coprophilus DSM 18228
BACCOPRO_01694 serB -134 5.6 AATTATGCTTTTAAACATAAAT
BACCOPRO_03681 PF10438 -53 5.5 TAATATGTTGGAAAACATATAA
BACCOPRO_01276 crp -33 4.6 TTTTGTGCTTAATAACACGATT
Bacteroides dorei DSM 17855
BACDOR_03634 araM -104 5.6 TTTTATGTTGCACAACATACTC
BACDOR_02848 serB -116 6.1 AAATATGTTATATAGCATAAAA
BACDOR_01705 PF01694 -71 6.2 TTTTCTGTTATATAACAGAATA
BACDOR_04003 null -33 4.5 TTTTAGGTTTAACAAATTAAAA
BACDOR_00927 PF09719 -110 4.6 AAAAGTGTTGAATAACATAATT
BACDOR_02265 fucR -114 5.1 TCTTGTGTTATAAAACATACCA
BACDOR_03939 PF10438 -58 5.4 AGATATGCTGAAAAACATATAA
BACDOR_01607 crp -35 4.1 ATTTGTGCTCTATAACACGGTT
BACDOR_00155 susC_Crp-2 -338 5.1 AGATATGTTCAACAACATACTA
BACDOR_00865 xylR -34 4.8 AATAGTGTTTTAGAACATAATA
Bacteroides eggerthii DSM 20697
BACEGG_02676 serB -74 6.3 TTTTATGTTATTTAGCATAAAA
BACEGG_03101 PF01694 -188 5.3 TAATATGTTACACAAAAGAAAA
BACEGG_03101 PF01694 -61 5.8 TTTTCTGTTATAGAACAGAATT
BACEGG_00156 null -129 5.5 TTTTGTGTTATAAAACATATTC
BACEGG_02642 xylR -92 4.8 AATAATGCTTTGTAACATATCA
BACEGG_01611 pflB -4 6.1 TTTTATGTTCTTCAGCATAAAA
BACEGG_02494 PF09719 -109 5.6 TAACGTGTTATATAACATAAAA
BACEGG_00870 susC_Rgu-1 -185 5.3 ATTTCTGCTTTACAACATACTC
BACEGG_00165 GH97 -92 5.2 GTATATGTTACACAACATGTAC
BACEGG_01340 crp -33 4.6 ATTTGTGCTGTACAACACAGTT
BACEGG_01333 nupG -193 5.8 GACTATGTTATATAACATAAAA
BACEGG_01536 araM -105 6.1 TTTTATGTTACATAACATACAA
Bacteroides fragilis NCTC 9343
BF2389 serB -71 6.2 TTTTATGTTATTTAGCATAAAT
BF4221 PF01694 -227 5 ATATATGTTACACAAAAGATAT
BF4221 PF01694 -105 5.7 TTTTCTGTTGTAGAACAGAATT
BF3646 null -151 6 TTTTATGTTGAATAACATATTT
BF1323 pflB -107 6.3 TTTTATGCTATTCAACATAAAA
BF2582 PF09719 -99 5.9 TAATCTGTTATATAACATAATT
BF0210 fucR -114 5.6 TTTGATGTTGTATAACATACCA
BF0315 BT1272 -90 5.7 TATTATGTTACAAAACATATAC
BF0594 susC_Crp-4 -162 5.4 TTCTATGTTATTAGACATAAAA
BF2354 xylR -81 4.6 AACAATGCTTTATAGCATATTA
BF0954 crp -33 4.6 ATTTGTGCTTTATAACACAGTT
BF0316 COG3533 -143 5.7 GTATATGTTTTGTAACATAATA
Bacteroides ovatus ATCC 8483
BACOVA_05132 nupG -269 5.6 CATTATGTTGTATAACATAAAC
BACOVA_02567 serB -66 6.3 TTTTATGTTATTTAGCATAAAA
BACOVA_01715 araM -105 5.9 ATTTATGCTGCACAACATATAA
BACOVA_02079 PF01694 -195 5 ATATATGTTACACAAAAGATTA
BACOVA_02079 PF01694 -66 5.4 TTTCATGCTTTAAAACAGAATT
BACOVA_03166 null -135 5.8 TTTTATGCTATAAAACATATTC
BACOVA_05597 pflB -113 6.1 TTTTATGTTGAAAAGCATAAAA
BACOVA_02257 PF09719 -107 5.3 TAAAGTGTTATATAACATAAAA
BACOVA_03849 fucR -100 5.8 TTTTCTGCTATAAAACATATCA
BACOVA_05152 crp -33 4.8 TTTTGTGCTGTATAACACAGTT
BACOVA_00860 uxuR -162 5.3 TCTTATGTTTAACAACATGTAT
BACOVA_02532 xylR -80 4.2 AACAATGTTTTATAGCATGTTT
Bacteroides plebeius DSM 17135
BACPLE_02214 araM -89 4.9 TTCTATGTTGAAAAACATCTGA
BACPLE_00736 null -116 5.5 TTTTATGTTATCCAACATATTC
BACPLE_02898 fucR -93 4.6 AAATCTGTTCTTAAACATAGCT
BACPLE_02167 crp -16 4.1 CTTTGTGCTTAATAACATGGTT
Bacteroides stercoris ATCC 43183
BACSTE_03522 nupG -230 5.7 CATTATGTTTTATAACATAAAT
BACSTE_01424 serB -74 6.3 TTTTATGTTATTTAGCATAAAA
BACSTE_02140 PF01694 -188 4.3 TTAATTGTTACACAAAAGAAAA
BACSTE_02140 PF01694 -61 5.8 TTTTCTGTTATAGAACAGAATT
BACSTE_03638 null -132 5.7 TTTTGTGTTATAAAACATAATC
BACSTE_00806 pflB -116 6.1 TTTTATGCTCTTCAACATAAAA
BACSTE_01186 PF09719 -110 5.4 TAACGTGCTATATAACATAAAA
BACSTE_01380 xylR -92 4.3 AATAATGCTTTATAACATTGTA
BACSTE_00464 susC_Crp-4 -162 5.3 AAACATGCTATTCAGCATAAAA
BACSTE_03515 crp -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides thetaiotaomicron VPI-5482
BT0832 serB -67 6.3 TTTTATGTTATTTAGCATAAAA
BT0356 araM -105 6.2 TTTTATGTTGCACAACATATAA
BT2831 PF01694 -192 4.9 ATATATGTTACACAAAAGATTT
BT2831 PF01694 -69 5 TTCCATGCTTTAAAACAGAATT
BT2178 null -135 5.4 TTTTATGCTATAAAACATATCG
BT4738 pflB -114 6.1 TTTTATGTTGAAAAGCATAAAA
BT1272 fucR -100 5.5 TTTCCTGCTATAGAACATATTA
BT2096 BT1272 -77 4.8 CTGTATGTTGTAAAACACATAC
BT1434 uxuR -207 5.1 TCTTATGTTTAACAACATACGT
BT4338 crp -33 4.8 TTTTGTGCTGTATAACACAGTT
BT0791 xylR -81 4.2 AACAATGTTTTATAGCATGTCA
BT2097 COG3533 -111 4.8 GTATGTGTTTTACAACATACAG
BT4080 sbp_Crp-1 -168 5.7 TTATATGTTATAGAATATAAAA
BT4330 nupG -271 5.7 CATTATGTTCTATAACATAAAA
Bacteroides uniformis ATCC 8492
BACUNI_00649 serB -75 6.2 TTTTATGTTATTTAGCATAAAT
BACUNI_03999 PF01694 -230 5 TAATATGTTACACAAAAGATAT
BACUNI_03999 PF01694 -97 5.8 TTTTCTGTTATAGAACAGAATT
BACUNI_03316 null -125 5.7 TTTTGTGTTATAAAACATATAC
BACUNI_00695 xylR -92 4.1 AATAATGCTTTATAATATTATA
BACUNI_04526 pflB -117 6.2 TTTTATGCTGTTCAACATAAAA
BACUNI_02281 PF09719 -105 5.3 TAACGTGTTGTATAACATAAAT
BACUNI_03327 xylD -91 5.5 GTATATGTTACACAACATATAC
BACUNI_01489 susC_Crp-3 -225 5 TTTTGTGTTATATAACATGTTG
BACUNI_01486 PF00722 -26 5.1 ACTTATGTTGTAAAATATATAT
BACUNI_04721 crp -33 4.7 ATTTGTGCTGTATAACACAGTT
BACUNI_01546 nupG -245 5 CAGCATGTTATATAACATAAAC
BACUNI_01357 araM -48 5.7 ACTTATGTTGCATAACATATAA
Bacteroides vulgatus ATCC 8482
BVU_2324 araM -104 5.6 TTTTATGTTGCACAACATACTC
BVU_3158 serB -116 6.1 AAATATGTTATATAGCATAAAA
BVU_3955 xylR -100 4.5 AATAGTGTTTTGGAACATAATA
BVU_0995 PF01694 -71 6.2 TTTTCTGTTATATAACAGAATA
BVU_2553 null -33 4.5 TTTTAGGTTTAACAAATTAAAA
BVU_3908 PF09719 -104 4.6 AAAAGTGTTGAATAACATAATT
BVU_1374 fucR -114 5 TCTTGTGTTATAAAACATACCT
BVU_2487 PF10438 -58 5.4 AGATATGCTGAAAAACATATAA
BVU_3580 crp -35 4.1 ATTTGTGCTCTATAACACGGTT
BVU_0299 susC_Crp-2 -340 4.9 AGATATGTTCAACAACATAGCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD