Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AraR in Bacteroidaceae

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Bacteroidaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides cellulosilyticus DSM 14838
BACCELL_00858 abn3 -39 5.4 TATGTGTATTTTTGACACCCA
BACCELL_05604 araM -60 5.8 AAAGTGTTACTTTTACACCCA
BACCELL_05604 araM -84 5.6 CAAGTGTTACTAATACACTCA
Bacteroides dorei DSM 17855
BACDOR_03634 araM -122 5.2 AAAGTGTAGGAAATACACTTT
BACDOR_03634 araM -59 5.6 ATAGTGTTACTTTTACACCCA
Bacteroides eggerthii DSM 20697
BACEGG_00165 agaL -46 5.7 AAGGTGTTATTTTTACACTCT
BACEGG_01536 araM -84 5.7 AAAGTGTATATATTACACCAA
BACEGG_00165 agaL -97 5 CAAGTGTATATGTTACACAAC
BACEGG_01536 araM -60 5.5 AAAGTGTTACTTTTACACCCG
Bacteroides ovatus ATCC 8483
BACOVA_03483 abf3 -138 5.1 AAAGTGTATATTTTACCCTTG
BACOVA_03483 abf3 -94 4.8 TAAGTGTATAATTACCAATTA
BACOVA_01715 araM -84 5.6 AGAGTGTATTTGATACACCAA
BACOVA_01715 araM -60 5.8 AAAGTGTTACTTTTACACCCA
Bacteroides plebeius DSM 17135
BACPLE_02644 abf1 -33 4.4 AAAGTGTGAAATAAACAAGTA
BACPLE_02644 abf1 -81 4.5 AAAATGTCAAATGTACACCCA
BACPLE_02214 araM -45 5.6 TAAGTGTTACTTTTACACCAT
BACPLE_02216 araP -94 5.6 TTAGTGTTACTAATACACTTT
Bacteroides thetaiotaomicron VPI-5482
BT0365 PF13385 -167 5.7 AAAGTGTAAAAAAGACACTTA
BT4163 BT4163 -329 5.1 AAATTGTATTATCTACACTCT
BT3047 sbp_Ara-4 -229 4.9 ATAATGTAAAATCTACACTCA
BT0356 araM -84 5.6 AGAGTGTATTTGATACACCAA
BT0356 araM -60 5.8 AAAGTGTTACTTTTACACCCA
Bacteroides uniformis ATCC 8492
BACUNI_01357 araM -27 4.2 AAAGTGTACAGCCTACACTAA
BACUNI_01357 araM -3 5.8 AAAGTGTTACTTTTACACCCA
BACUNI_03327 abn3 -96 5.2 TAAGTGTATATGTTACACAAC
BACUNI_03327 abn3 -46 5.4 ATAGTGTTAATTTTACACCCG
Bacteroides vulgatus ATCC 8482
BVU_2324 araM -122 5.2 AAAGTGTAGGAAATACACTTT
BVU_2324 araM -59 5.4 ATAGTGTTACTTTTACACCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD