Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FucR in Bacteroidaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Fucose utilization
Effector: Fucose
Regulog: FucR - Bacteroidaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides cellulosilyticus DSM 14838
BACCELL_04988 fucR -69 6.3 CTTTGCACCAGCACAGTTCAGCACAG
Bacteroides dorei DSM 17855
BACDOR_02265 fucR -59 6.2 CTTTGCATCGGGACAGTTCAGCACAG
Bacteroides fragilis NCTC 9343
BF0210 fucR -59 6 CTTTGTATCATGATAGTTCAGCATAG
BF0211 fucI -57 5.1 CTGTGTGTCAGCACAGGTCAGCATAG
Bacteroides ovatus ATCC 8483
BACOVA_03849 fucR -45 6.6 CTTTGCATCAGCATAGTTCAGCATAG
Bacteroides plebeius DSM 17135
BACPLE_02898 fucR -39 5.8 CTTTGTGTCAGGATAGTTCAGCACAG
Bacteroides thetaiotaomicron VPI-5482
BT1272 fucR -45 6.4 CTTTGCAACAGCATAGCTCAGCACAG
Bacteroides vulgatus ATCC 8482
BVU_1374 fucR -59 6.2 CTTTGCATCGGGACAGTTCAGCACAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD