Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CelR in Lactobacillaceae

Properties
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog: CelR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_0927 bglA -83 6.8 TTTCCGCAAGTATGAGGAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD